Myoglobin (MB) (NM_203378) Human Untagged Clone
CAT#: SC308145
MB (untagged)-Human myoglobin (MB), transcript variant 3
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PVALB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308145 representing NM_203378.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGCTCAGCGACGGGGAATGGCAGTTGGTGCTGAACGTCTGGGGGAAGGTGGAGGCTGACATCCCA GGCCATGGGCAGGAAGTCCTCATCAGGCTCTTTAAGGGTCACCCAGAGACTCTGGAGAAGTTTGACAAG TTCAAGCACCTGAAGTCAGAGGACGAGATGAAGGCGTCTGAGGACTTAAAGAAGCATGGTGCCACCGTG CTCACCGCCCTGGGTGGCATCCTTAAGAAGAAGGGGCATCATGAGGCAGAGATTAAGCCCCTGGCACAG TCGCATGCCACCAAGCACAAGATCCCCGTGAAGTACCTGGAGTTCATCTCGGAATGCATCATCCAGGTT CTGCAGAGCAAGCATCCCGGGGACTTTGGTGCTGATGCCCAGGGGGCCATGAACAAGGCCCTGGAGCTG TTCCGGAAGGACATGGCCTCCAACTACAAGGAGCTGGGCTTCCAGGGCTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_203378 |
Insert Size | 465 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_203378.1 |
RefSeq Size | 1153 bp |
RefSeq ORF | 465 bp |
Locus ID | 4151 |
UniProt ID | P02144 |
MW | 17.2 kDa |
Gene Summary | This gene encodes a member of the globin superfamily and is predominantly expressed in skeletal and cardiac muscles. The encoded protein forms a monomeric globular haemoprotein that is primarily responsible for the storage and facilitated transfer of oxygen from the cell membrane to the mitochondria. This protein also plays a role in regulating physiological levels of nitric oxide. Multiple transcript variants encoding distinct isoforms exist for this gene. [provided by RefSeq, May 2020] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1-4 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC203113 | MB (Myc-DDK-tagged)-Human myoglobin (MB), transcript variant 3 |
CNY 1200.00 |
|
RC203113L3 | Lenti ORF clone of Human myoglobin (MB), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
RC203113L4 | Lenti ORF clone of Human myoglobin (MB), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
RG203113 | MB (tGFP-tagged) - Human myoglobin (MB), transcript variant 3 |
CNY 4370.00 |
|
SC320890 | MB (untagged)-Human myoglobin (MB), transcript variant 3 |
CNY 1200.00 |
其它Myoglobin产品