PRKACA (NM_207518) Human Untagged Clone

CAT#: SC308605

PRKACA (untagged)-Human protein kinase, cAMP-dependent, catalytic, alpha (PRKACA), transcript variant 2



  "NM_207518" in other vectors (4)

CNY 5488.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Phospho-PKA alpha/beta/gamma (Thr197) Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAFD1; PKACA; PPNAD4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_207518, the custom clone sequence may differ by one or more nucleotides


ATGGCTTCCAACTCCAGCGATGTGAAAGAATTCTTAGCCAAAGCCAAAGAAGATTTTCTTAAAAAATGGG
AAAGTCCCGCTCAGAACACAGCCCACTTGGATCAGTTTGAACGAATCAAGACCCTCGGCACGGGCTCCTT
CGGGCGGGTGATGCTGGTGAAACACAAGGAGACCGGGAACCACTATGCCATGAAGATCCTCGACAAACAG
AAGGTGGTGAAACTGAAACAGATCGAACACACCCTGAATGAAAAGCGCATCCTGCAAGCTGTCAACTTTC
CGTTCCTCGTCAAACTCGAGTTCTCCTTCAAGGACAACTCAAACTTATACATGGTCATGGAGTACGTGCC
CGGCGGGGAGATGTTCTCACACCTACGGCGGATCGGAAGGTTCAGTGAGCCCCATGCCCGTTTCTACGCG
GCCCAGATCGTCCTGACCTTTGAGTATCTGCACTCGCTGGATCTCATCTACAGGGACCTGAAGCCGGAGA
ATCTGCTCATTGACCAGCAGGGCTACATTCAGGTGACAGACTTCGGTTTCGCCAAGCGCGTGAAGGGCCG
CACTTGGACCTTGTGCGGCACCCCTGAGTACCTGGCCCCTGAGATTATCCTGAGCAAAGGCTACAACAAG
GCCGTGGACTGGTGGGCCCTGGGGGTTCTTATCTATGAAATGGCCGCTGGCTACCCGCCCTTCTTCGCAG
ACCAGCCCATCCAGATCTATGAGAAGATCGTCTCTGGGAAGGTGCGCTTCCCTTCCCACTTCAGCTCTGA
CTTGAAGGACCTGCTGCGGAACCTCCTGCAGGTAGATCTCACCAAGCGCTTTGGGAACCTCAAGAATGGG
GTCAACGATATCAAGAACCACAAGTGGTTTGCCACAACTGACTGGATTGCCATCTACCAGAGGAAGGTGG
AAGCTCCCTTCATACCAAAGTTTAAAGGCCCTGGGGATACGAGTAACTTTGACGACTATGAGGAAGAAGA
AATCCGGGTCTCCATCAATGAGAAGTGTGGCAAGGAGTTTTCTGAGTTTTAG


Restriction Sites Please inquire     
ACCN NM_207518
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_207518.1, NP_997401.1
RefSeq Size 2490 bp
RefSeq ORF 1032 bp
Locus ID 5566
UniProt ID P17612
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Apoptosis, Calcium signaling pathway, Chemokine signaling pathway, Dilated cardiomyopathy, Gap junction, GnRH signaling pathway, Hedgehog signaling pathway, Insulin signaling pathway, Long-term potentiation, MAPK signaling pathway, Melanogenesis, Olfactory transduction, Oocyte meiosis, Prion diseases, Progesterone-mediated oocyte maturation, Taste transduction, Vascular smooth muscle contraction, Vibrio cholerae infection, Wnt signaling pathway
Gene Summary This gene encodes one of the catalytic subunits of protein kinase A, which exists as a tetrameric holoenzyme with two regulatory subunits and two catalytic subunits, in its inactive form. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. cAMP-dependent phosphorylation of proteins by protein kinase A is important to many cellular processes, including differentiation, proliferation, and apoptosis. Constitutive activation of this gene caused either by somatic mutations, or genomic duplications of regions that include this gene, have been associated with hyperplasias and adenomas of the adrenal cortex and are linked to corticotropin-independent Cushing's syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. Tissue-specific isoforms that differ at the N-terminus have been described, and these isoforms may differ in the post-translational modifications that occur at the N-terminus of some isoforms. [provided by RefSeq, Jan 2015]
Transcript Variant: This variant (2) contains an alternate 5' terminal exon and initiates translation at an alternate start codon, compared to variant 1. It encodes Calpha2, PMID:21812984 (also known as C alpha-s, PMID: 10906071) which has a shorter and distinct N-terminus, compared to Calpha1. This variant is specifically expressed in spermatogenic cells and may be essential for male fertility.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...