PRKACA (NM_207518) Human Untagged Clone
CAT#: SC308605
PRKACA (untagged)-Human protein kinase, cAMP-dependent, catalytic, alpha (PRKACA), transcript variant 2
CNY 5488.00
| Cited in 1 publication. | 
Product images
                    
                Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | CAFD1; PKACA; PPNAD4 | 
| Vector | pCMV6-Entry | 
| E. coli Selection | Kanamycin (25 ug/mL) | 
| Mammalian Cell Selection | Neomycin | 
| Sequence Data | 
                
                
                
                 >NCBI ORF sequence for NM_207518, the custom clone sequence may differ by one or more nucleotides 
ATGGCTTCCAACTCCAGCGATGTGAAAGAATTCTTAGCCAAAGCCAAAGAAGATTTTCTTAAAAAATGGG AAAGTCCCGCTCAGAACACAGCCCACTTGGATCAGTTTGAACGAATCAAGACCCTCGGCACGGGCTCCTT CGGGCGGGTGATGCTGGTGAAACACAAGGAGACCGGGAACCACTATGCCATGAAGATCCTCGACAAACAG AAGGTGGTGAAACTGAAACAGATCGAACACACCCTGAATGAAAAGCGCATCCTGCAAGCTGTCAACTTTC CGTTCCTCGTCAAACTCGAGTTCTCCTTCAAGGACAACTCAAACTTATACATGGTCATGGAGTACGTGCC CGGCGGGGAGATGTTCTCACACCTACGGCGGATCGGAAGGTTCAGTGAGCCCCATGCCCGTTTCTACGCG GCCCAGATCGTCCTGACCTTTGAGTATCTGCACTCGCTGGATCTCATCTACAGGGACCTGAAGCCGGAGA ATCTGCTCATTGACCAGCAGGGCTACATTCAGGTGACAGACTTCGGTTTCGCCAAGCGCGTGAAGGGCCG CACTTGGACCTTGTGCGGCACCCCTGAGTACCTGGCCCCTGAGATTATCCTGAGCAAAGGCTACAACAAG GCCGTGGACTGGTGGGCCCTGGGGGTTCTTATCTATGAAATGGCCGCTGGCTACCCGCCCTTCTTCGCAG ACCAGCCCATCCAGATCTATGAGAAGATCGTCTCTGGGAAGGTGCGCTTCCCTTCCCACTTCAGCTCTGA CTTGAAGGACCTGCTGCGGAACCTCCTGCAGGTAGATCTCACCAAGCGCTTTGGGAACCTCAAGAATGGG GTCAACGATATCAAGAACCACAAGTGGTTTGCCACAACTGACTGGATTGCCATCTACCAGAGGAAGGTGG AAGCTCCCTTCATACCAAAGTTTAAAGGCCCTGGGGATACGAGTAACTTTGACGACTATGAGGAAGAAGA AATCCGGGTCTCCATCAATGAGAAGTGTGGCAAGGAGTTTTCTGAGTTTTAG  | 
        
| Restriction Sites | Please inquire | 
| ACCN | NM_207518 | 
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info  | 
        
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_207518.1, NP_997401.1 | 
| RefSeq Size | 2490 bp | 
| RefSeq ORF | 1032 bp | 
| Locus ID | 5566 | 
| UniProt ID | P17612 | 
| Protein Families | Druggable Genome, Protein Kinase | 
| Protein Pathways | Apoptosis, Calcium signaling pathway, Chemokine signaling pathway, Dilated cardiomyopathy, Gap junction, GnRH signaling pathway, Hedgehog signaling pathway, Insulin signaling pathway, Long-term potentiation, MAPK signaling pathway, Melanogenesis, Olfactory transduction, Oocyte meiosis, Prion diseases, Progesterone-mediated oocyte maturation, Taste transduction, Vascular smooth muscle contraction, Vibrio cholerae infection, Wnt signaling pathway | 
| Gene Summary | This gene encodes one of the catalytic subunits of protein kinase A, which exists as a tetrameric holoenzyme with two regulatory subunits and two catalytic subunits, in its inactive form. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. cAMP-dependent phosphorylation of proteins by protein kinase A is important to many cellular processes, including differentiation, proliferation, and apoptosis. Constitutive activation of this gene caused either by somatic mutations, or genomic duplications of regions that include this gene, have been associated with hyperplasias and adenomas of the adrenal cortex and are linked to corticotropin-independent Cushing's syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. Tissue-specific isoforms that differ at the N-terminus have been described, and these isoforms may differ in the post-translational modifications that occur at the N-terminus of some isoforms. [provided by RefSeq, Jan 2015] Transcript Variant: This variant (2) contains an alternate 5' terminal exon and initiates translation at an alternate start codon, compared to variant 1. It encodes Calpha2, PMID:21812984 (also known as C alpha-s, PMID: 10906071) which has a shorter and distinct N-terminus, compared to Calpha1. This variant is specifically expressed in spermatogenic cells and may be essential for male fertility.  | 
        
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: | 
|---|
| 
                                                Constitutive activation of PKA catalytic subunit in adrenal Cushing's syndrome
                                                ,Beuschlein, F;Fassnacht, M;Assié, G;Calebiro, D;Stratakis, CA;Osswald, A;Ronchi, CL;Wieland, T;Sbiera, S;Faucz, FR;Schaak, K;Schmittfull, A;Schwarzmayr, T;Barreau, O;Vezzosi, D;Rizk-Rabin, M;Zabel, U;Szarek, E;Salpea, P;Forlino, A;Vetro, A;Zuffardi, O;Kisker, C;Diener, S;Meitinger, T;Lohse, MJ;Reincke, M;Bertherat, J;Strom, TM;Allolio, B;,
                                                N. Engl. J. Med.
                                                ,PubMed ID 24571724
                                                [PRKACA]
                                                 | 
                                        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC220877 | PRKACA (Myc-DDK-tagged)-Human protein kinase, cAMP-dependent, catalytic, alpha (PRKACA), transcript variant 2 | 
                                                     CNY 5488.00  | 
                                            |
| RC220877L3 | Lenti ORF clone of Human protein kinase, cAMP-dependent, catalytic, alpha (PRKACA), transcript variant 2, Myc-DDK-tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC220877L4 | Lenti ORF clone of Human protein kinase, cAMP-dependent, catalytic, alpha (PRKACA), transcript variant 2, mGFP tagged | 
                                                     CNY 5890.00  | 
                                            |
| RG220877 | PRKACA (tGFP-tagged) - Human protein kinase, cAMP-dependent, catalytic, alpha (PRKACA), transcript variant 2 | 
                                                     CNY 7088.00  | 
                                            
