INCA1 (NM_213726) Human Untagged Clone

CAT#: SC308707

INCA1 (untagged)-Human inhibitor of CDK, cyclin A1 interacting protein 1 (INCA1), transcript variant 3



  "NM_213726" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSD45
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308707 representing NM_213726.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGGTGCAGGATGATGGAGTCAACCTCATCCCCTTTGCCAAGTGTTCCAGGGTGGTCAGCCGATCT
CCACCCCCAAGGTTGCCTTCCCAGAGCCTCAGACCCATGCCCCAGCGTTATGGAGATGTCTTCTGGAAG
AACCTTAATCAAAGGCCCACCCCCACTTGGCTGGAGGAGCAGCACATTCCACCCATGCTGCTCCCACCC
CCTGAAATGCTTTGGAGAAGAAAGAAGAGGAGGCCATGTTTGGAAGGAATGCAGCAGCAGGGCCTTGGG
GGAGTCCCCGCCCGGGTGAGGGCTGTCACTTACCACCTGGAGGACCTAAGAAGGCGTCAGAGCATCATC
AACGAACTGAAGAAGGCCCAGTGGGGCAGCTCTGGGGCTGCATCTGAGCCAGTGGTGCTTGGCGAAGAG
GGCTGTGGATTCCCCAGCACCAATGAATACCCTGATCTGGAAGAGGAGAGAGCAACCTATCCACAGGAA
GAGGACCGTTTTCTCACTCCTGGCAGGGCCCAGCTGCTTTGGTCTCCCTGGAGCCCCCTGGATCAGGAG
GAGGCTTGTGCCTCCAGGCAGCTGCACTCTCTGGCCTCGTTCAGCACTGTCACAGCCAGAAGGAACCCC
CTTCACAATCCCTGGGGGATGGAGTTGGCAGCGTCTGAAGAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_213726
Insert Size 666 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_213726.2
RefSeq Size 1404 bp
RefSeq ORF 666 bp
Locus ID 388324
UniProt ID Q0VD86
MW 25.2 kDa
Gene Summary Binds to CDK2-bound cyclins and inhibits the kinase activity of CDK2; binding to cyclins is critical for its function as CDK inhibitor (PubMed:21540187). Inhibits cell growth and cell proliferation and may play a role in cell cycle control (By similarity). Required for ING5-mediated regulation of S-phase progression, enhancement of Fas-induced apoptosis and inhibition of cell growth (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) differs in the 5' UTR and uses an alternate in-frame splice site in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Both variants 3 and 4 encode the same isoform (2).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...