PTP4A3 (NM_032611) Human Untagged Clone

CAT#: SC308739

PTP4A3 (untagged)-Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 1



  "NM_032611" in other vectors (6)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Cited in 5 publications.

Product images

推荐一起购买 (3)
PTP4A3 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PRL-3; PRL-R; PRL3
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_032611 edited
TGACTATCCAGCTCTGAGAGACGGGAGTTTGGAGTTGCCCGCTTTACTTTGGTTGGGTTG
GGGGGGGCGGCGGGCTGTTTTGTTCCTTTTCTTTTTTAAGAGTTGGGTTTTCTTTTTTAA
TTATCCAAACAGTGGGCAGCTTCCTCCCCCACACCCAAGTATTTGCACAATATTTGTGCG
GGGTATGGGGGTGGGTTTTTAAATCTCGTTTCTCTTGGACAAGCACAGGGATCTCGTTCT
CCTCATTTTTTGGGGGTGTGTGGGGACTTCTCAGGTCGTGTCCCCAGCCTTCTCTGCAGT
CCCTTCTGCCCTGCCGGGCCCGTCGGGAGGCGCCATGGCTCGGATGAACCGCCCGGCCCC
GGTGGAGGTGAGCTACAAACACATGCGCTTCCTCATCACCCACAACCCCACCAACGCCAC
GCTCAGCACCTTCATTGAGGACCTGAAGAAGTACGGGGCTACCACTGTGGTGCGTGTGTG
TGAAGTGACCTATGACAAAACGCCGCTGGAGAAGGATGGCATCACCGTTGTGGACTGGCC
GTTTGACGATGGGGCGCCCCCGCCCGGCAAGGTAGTGGAAGACTGGCTGAGCCTGGTGAA
GGCCAAGTTCTGTGAGGCCCCCGGCAGCTGCGTGGCTGTGCACTGCGTGGCGGGCCTGGG
CCGGGCTCCAGTCCTTGTGGCGCTGGCGCTTATTGAGAGCGGGATGAAGTACGAGGACGC
CATCCAGTTCATCCGCCAGAAGCGCCGCGGAGCCATCAACAGCAAGCAGCTCACCTACCT
GGAGAAATACCGGCCCAAACAGAGGCTGCGGTTCAAAGACCCACACACGCACAAGACCCG
GTGCTGCGTTATGTAGCTCAGGACCTTGGCTGGGCCTGGTCGTCATGTAGGTCAGGACCT
TGGCTGGACCTGGAGGCCCTGCCCAGCCCTGCTCTGCCCAGCCCAGCAGGGGCTCCAGGC
CTTGGCTGGCCCCACATCGCCTTTTCCTCCCCGACACCTCCGTGCACTTGTGTCCGAGGA
GCGAGGAGCCCCTCGGGCCCTGGGTGGCCTCTGGGCCCTTTCTCCTGTCTCCGCCACTCC
CTCTGGCGGCGCTGGCCGTGGCTCTGTCTCTCTGAGGTGGGTCGGGCGCCCTCTGCCCGC
CCCCTCCCACACCAGCCAGGCTGGTCTCCTCTAGCCTGTTTGTTGTGGGGTGGGGGTATA
TTTTGTAACCACTGGGCCCCCAGCCCCTCTTTTGCGACCCCTTGTCCTGACCTGTTCTCG
GCACCTTAAATTATTAGACCCCGGGGCAGTCAGGTGCTCCGGACACCCGAAGGCAATAAA
ACAGGAGCCGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_032611
Insert Size 1400 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_032611.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_032611.1, NP_116000.1
RefSeq Size 1396 bp
RefSeq ORF 522 bp
Locus ID 11156
UniProt ID O75365
Protein Families Druggable Genome, Phosphatase
Gene Summary This gene encodes a member of the protein-tyrosine phosphatase family. Protein tyrosine phosphatases are cell signaling molecules that play regulatory roles in a variety of cellular processes. Studies of this class of protein tyrosine phosphatase in mice demonstrates that they are prenylated in vivo, suggesting their association with cell plasma membrane. The encoded protein may enhance cell proliferation, and overexpression of this gene has been implicated in tumor metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (5)

Other Versions

Customer Reviews 
Loading...