PTP4A3 (NM_032611) Human Untagged Clone
CAT#: SC308739
PTP4A3 (untagged)-Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 1
CNY 3600.00
| Cited in 5 publications. | 
Product images
                    
                Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | PRL-3; PRL-R; PRL3 | 
| Vector | pCMV6-XL5 | 
| E. coli Selection | Ampicillin (100 ug/mL) | 
| Mammalian Cell Selection | None | 
| Sequence Data | 
                
                
                
                 >OriGene sequence for NM_032611 edited 
TGACTATCCAGCTCTGAGAGACGGGAGTTTGGAGTTGCCCGCTTTACTTTGGTTGGGTTG GGGGGGGCGGCGGGCTGTTTTGTTCCTTTTCTTTTTTAAGAGTTGGGTTTTCTTTTTTAA TTATCCAAACAGTGGGCAGCTTCCTCCCCCACACCCAAGTATTTGCACAATATTTGTGCG GGGTATGGGGGTGGGTTTTTAAATCTCGTTTCTCTTGGACAAGCACAGGGATCTCGTTCT CCTCATTTTTTGGGGGTGTGTGGGGACTTCTCAGGTCGTGTCCCCAGCCTTCTCTGCAGT CCCTTCTGCCCTGCCGGGCCCGTCGGGAGGCGCCATGGCTCGGATGAACCGCCCGGCCCC GGTGGAGGTGAGCTACAAACACATGCGCTTCCTCATCACCCACAACCCCACCAACGCCAC GCTCAGCACCTTCATTGAGGACCTGAAGAAGTACGGGGCTACCACTGTGGTGCGTGTGTG TGAAGTGACCTATGACAAAACGCCGCTGGAGAAGGATGGCATCACCGTTGTGGACTGGCC GTTTGACGATGGGGCGCCCCCGCCCGGCAAGGTAGTGGAAGACTGGCTGAGCCTGGTGAA GGCCAAGTTCTGTGAGGCCCCCGGCAGCTGCGTGGCTGTGCACTGCGTGGCGGGCCTGGG CCGGGCTCCAGTCCTTGTGGCGCTGGCGCTTATTGAGAGCGGGATGAAGTACGAGGACGC CATCCAGTTCATCCGCCAGAAGCGCCGCGGAGCCATCAACAGCAAGCAGCTCACCTACCT GGAGAAATACCGGCCCAAACAGAGGCTGCGGTTCAAAGACCCACACACGCACAAGACCCG GTGCTGCGTTATGTAGCTCAGGACCTTGGCTGGGCCTGGTCGTCATGTAGGTCAGGACCT TGGCTGGACCTGGAGGCCCTGCCCAGCCCTGCTCTGCCCAGCCCAGCAGGGGCTCCAGGC CTTGGCTGGCCCCACATCGCCTTTTCCTCCCCGACACCTCCGTGCACTTGTGTCCGAGGA GCGAGGAGCCCCTCGGGCCCTGGGTGGCCTCTGGGCCCTTTCTCCTGTCTCCGCCACTCC CTCTGGCGGCGCTGGCCGTGGCTCTGTCTCTCTGAGGTGGGTCGGGCGCCCTCTGCCCGC CCCCTCCCACACCAGCCAGGCTGGTCTCCTCTAGCCTGTTTGTTGTGGGGTGGGGGTATA TTTTGTAACCACTGGGCCCCCAGCCCCTCTTTTGCGACCCCTTGTCCTGACCTGTTCTCG GCACCTTAAATTATTAGACCCCGGGGCAGTCAGGTGCTCCGGACACCCGAAGGCAATAAA ACAGGAGCCGTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA  | 
        
| Restriction Sites | Please inquire | 
| ACCN | NM_032611 | 
| Insert Size | 1400 bp | 
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info  | 
        
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_032611.1. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.  | 
        
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_032611.1, NP_116000.1 | 
| RefSeq Size | 1396 bp | 
| RefSeq ORF | 522 bp | 
| Locus ID | 11156 | 
| UniProt ID | O75365 | 
| Protein Families | Druggable Genome, Phosphatase | 
| Gene Summary | This gene encodes a member of the protein-tyrosine phosphatase family. Protein tyrosine phosphatases are cell signaling molecules that play regulatory roles in a variety of cellular processes. Studies of this class of protein tyrosine phosphatase in mice demonstrates that they are prenylated in vivo, suggesting their association with cell plasma membrane. The encoded protein may enhance cell proliferation, and overexpression of this gene has been implicated in tumor metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.  | 
        
Citations (5)
| The use of this cDNA Clones has been cited in the following citations: | 
|---|
| 
                                                Credentialing and Pharmacologically Targeting PTP4A3 Phosphatase as a Molecular Target for Ovarian Cancer
                                                ,null,
                                                Biomolecules
                                                ,PubMed ID 34209460
                                                [PTP4A3]
                                                 | 
                                        
| 
                                                Chemotherapy induced PRL3 expression promotes cancer growth via plasma membrane remodeling and specific alterations of caveolae-associated signaling
                                                ,Csoboz, B;Gombos, I;Tatrai, E;Tovari, J;Kiss, AL;Horvath, I;Vigh, L;,
                                                Cell Commun. Signal
                                                ,PubMed ID 30157875
                                                [PTP4A3]
                                                 | 
                                        
| 
                                                Loss of the oncogenic phosphatase PRL-3 promotes a TNF-R1 feedback loop that mediates triple-negative breast cancer growth
                                                ,Gari, HH;DeGala, GD;Lucia, MS;Lambert, JR;,
                                                Oncogenesis
                                                ,PubMed ID 27526109
                                                [PTP4A3]
                                                 | 
                                        
| 
                                                PRL-3 engages the focal adhesion pathway in triple-negative breast cancer cells to alter actin structure and substrate adhesion properties critical for cell migration and invasion
                                                ,Gari, HH;DeGala, GD;Ray, R;Lucia, MS;Lambert, JR;,
                                                Cancer Lett.
                                                ,PubMed ID 27452906
                                                [PTP4A3]
                                                 | 
                                        
| 
                                                Genome-wide functional genetic screen with the anticancer agent AMPI-109 identifies PRL-3 as an oncogenic driver in triple-negative breast cancers
                                                ,null,
                                                Oncotarget
                                                ,PubMed ID 26909599
                                                [PTP4A3]
                                                 | 
                                        
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC212193 | PTP4A3 (Myc-DDK-tagged)-Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 1 | 
                                                     
                                                        
                                                        
                                                        
                                                            CNY 3600.00  | 
                                            |
| RC212193L1 | Lenti ORF clone of Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 1, Myc-DDK-tagged | 
                                                     CNY 6000.00  | 
                                            |
| RC212193L2 | Lenti ORF clone of Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 1, mGFP tagged | 
                                                     CNY 5890.00  | 
                                            |
| RC212193L3 | Lenti ORF clone of Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 1, Myc-DDK-tagged | 
                                                     CNY 6000.00  | 
                                            |
| RC212193L4 | Lenti ORF clone of Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 1, mGFP tagged | 
                                                     CNY 6000.00  | 
                                            |
| RG212193 | PTP4A3 (tGFP-tagged) - Human protein tyrosine phosphatase type IVA, member 3 (PTP4A3), transcript variant 1 | 
                                                     CNY 5200.00  | 
                                            
