BNIP1 (NM_013979) Human Untagged Clone

CAT#: SC308932

BNIP1 (untagged)-Human BCL2/adenovirus E1B 19kDa interacting protein 1 (BNIP1), transcript variant BNIP1-b



  "NM_013979" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
BNIP1 mouse monoclonal antibody, clone OTI2B3 (formerly 2B3)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NIP1; SEC20; TRG-8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308932 representing NM_013979.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCTCCCCAAGACGTCCACGTCCGGATCTGTAACCAAGAGATTGTCAAATTTGACCTGGAGGTG
AAGGCGCTTATTCAGGATATCCGTGATTGTTCAGGACCCTTAAGTGCTCTTACTGAACTGAATACTAAA
GTAAAAGAGAAATTTCAACAGTTGCGTCACAGAATACAGCCAGTTCTCTATCAAAGGGCATTTATTTGG
ACTGCTTCCACATTTTTTTTTAAGCTAACTTATTCCCTGACAGACTTTTCTTCAACTCAGCATGACTTC
AACTCTCCAACTACACCTGTTACCTTCAGTGACCTGGAGCAGTTGGCTAAAGAGCAAGACAAAGAATCA
GAGAAACAACTTCTACTCCAGGAAGTGGAGAATCACAAAAAGCAGATGCTCAGCAATCAGGCCTCATGG
AGGAAAGCTAATCTCACCTGCAAAATTGCAATCGACAATCTAGAGAAAGCAGAACTTCTTCAGGGAGGA
GATCTCTTAAGGCAAAGGAAAACCACCAAAGAGAGCCTGGCCCAGACATCCAGTACCATCACTGAGAGC
CTCATGGGGATCAGCAGGATGATGGCCCAGCAGGTCCAGCAGAGCGAGGAGGCCATGCAGTCTCTAGTC
ACTTCTTCACGAACGATCCTGGATGCAAATGAAGAATTTAAGTCCATGTCGGGCACCATCCAGCTGGGC
CGGAAGCTTATCACAAAATACAATCGCCGGGAGCTGACGGACAAGCTTCTCATCTTCCTTGCGCTAGCC
CTGTTTCTTGCTACGGTCCTCTATATTGTGAAAAAGCGGCTCTTTCCATTTTTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_013979
Insert Size 816 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_013979.2
RefSeq Size 1388 bp
RefSeq ORF 816 bp
Locus ID 662
UniProt ID Q12981
Protein Families Druggable Genome, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
MW 31.1 kDa
Gene Summary This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. In addition, this protein is involved in vesicle transport into the endoplasmic reticulum. Alternative splicing of this gene results in four protein products with identical N- and C-termini. [provided by RefSeq, Mar 2011]
Transcript Variant: Transcript variant BNIP1-b contains a 129-nucleotide in-frame insertion relative to the full-length BNIP1 variant. This variant contains a fully conserved BH3 domain which has been associated with pro-apoptotic function.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...