RAD51 (NM_002875) Human Untagged Clone
CAT#: SC309019
RAD51 (untagged)-Human RAD51 homolog (S. cerevisiae) (RAD51), transcript variant 1
CNY 5488.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BRCC5; FANCR; HRAD51; HsRad51; HsT16930; MRMV2; RAD51A; RECA |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_133487, the custom clone sequence may differ by one or more nucleotides
ATGGCAATGCAGATGCAGCTTGAAGCAAATGCAGATACTTCAGTGGAAGAAGAAAGCTTTGGCCCACAAC CCATTTCACGGTTAGAGCAGTGTGGCATAAATGCCAACGATGTGAAGAAATTGGAAGAAGCTGGATTCCA TACTGTGGAGGCTGTTGCCTATGCGCCAAAGAAGGAGCTAATAAATATTAAGGGAATTAGTGAAGCCAAA GCTGATAAAATTCTGACGGAGTCTCGCTCTGTTGCCAGGCTGGAGTGCAATAGCGTGATCTTGGTCTACT GCACCCTCCGCCTCTCAGGTTCAAGTGATTCTCCTGCCTCAGCCTCCCGAGTAGTTGGGACTACAGGTGG AATTGAGACTGGATCTATCACAGAAATGTTTGGAGAATTCCGAACTGGGAAGACCCAGATCTGTCATACG CTAGCTGTCACCTGCCAGCTTCCCATTGACCGGGGTGGAGGTGAAGGAAAGGCCATGTACATTGACACTG AGGGTACCTTTAGGCCAGAACGGCTGCTGGCAGTGGCTGAGAGGTATGGTCTCTCTGGCAGTGATGTCCT GGATAATGTAGCATATGCTCGAGCGTTCAACACAGACCACCAGACCCAGCTCCTTTATCAAGCATCAGCC ATGATGGTAGAATCTAGGTATGCACTGCTTATTGTAGACAGTGCCACCGCCCTTTACAGAACAGACTACT CGGGTCGAGGTGAGCTTTCAGCCAGGCAGATGCACTTGGCCAGGTTTCTGCGGATGCTTCTGCGACTCGC TGATGAGTTTGGTGTAGCAGTGGTAATCACTAATCAGGTGGTAGCTCAAGTGGATGGAGCAGCGATGTTT GCTGCTGATCCCAAAAAACCTATTGGAGGAAATATCATCGCCCATGCATCAACAACCAGATTGTATCTGA GGAAAGGAAGAGGGGAAACCAGAATCTGCAAAATCTACGACTCTCCCTGTCTTCCTGAAGCTGAAGCTAT GTTCGCCATTAATGCAGATGGAGTGGGAGATGCCAAAGACTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_002875 |
| Insert Size | 2700 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_002875.3. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002875.2, NP_002866.2 |
| RefSeq Size | 2254 bp |
| RefSeq ORF | 1020 bp |
| Locus ID | 5888 |
| UniProt ID | Q06609 |
| Protein Families | Druggable Genome, Stem cell - Pluripotency, Transcription Factors |
| Protein Pathways | Homologous recombination, Pancreatic cancer, Pathways in cancer |
| Gene Summary | The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are highly similar to bacterial RecA and Saccharomyces cerevisiae Rad51, and are known to be involved in the homologous recombination and repair of DNA. This protein can interact with the ssDNA-binding protein RPA and RAD52, and it is thought to play roles in homologous pairing and strand transfer of DNA. This protein is also found to interact with BRCA1 and BRCA2, which may be important for the cellular response to DNA damage. BRCA2 is shown to regulate both the intracellular localization and DNA-binding ability of this protein. Loss of these controls following BRCA2 inactivation may be a key event leading to genomic instability and tumorigenesis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009] Transcript Variant: This variant (1) uses an alternate exon in the 5' coding region, compared to variant 2. The resulting isoform (1) contains a distinct segment near the N-terminus, compared to isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Fibroblast growth factor receptor 4 induced resistance to radiation therapy in colorectal cancer
,Ahmed, MA;Selzer, E;Dörr, W;Jomrich, G;Harpain, F;Silberhumer, GR;Müllauer, L;Holzmann, K;Grasl-Kraupp, B;Grusch, M;Berger, W;Marian, B;,
Oncotarget
,PubMed ID 27650548
[RAD51]
|
|
Protective role of miR-155 in breast cancer through RAD51 targeting impairs homologous recombination after irradiation
,Gasparini, P;Lovat, F;Fassan, M;Casadei, L;Cascione, L;Jacob, NK;Carasi, S;Palmieri, D;Costinean, S;Shapiro, CL;Huebner, K;Croce, CM;,
Proc. Natl. Acad. Sci. U.S.A.
,PubMed ID 24616504
[RAD51]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218333 | RAD51 (Myc-DDK-tagged)-Human RAD51 homolog (S. cerevisiae) (RAD51), transcript variant 1 |
CNY 5488.00 |
|
| RC218333L1 | Lenti ORF clone of Human RAD51 homolog (S. cerevisiae) (RAD51), transcript variant 1, Myc-DDK-tagged |
CNY 7888.00 |
|
| RC218333L2 | Lenti ORF clone of Human RAD51 homolog (S. cerevisiae) (RAD51), transcript variant 1, mGFP tagged |
CNY 7888.00 |
|
| RC218333L3 | Lenti ORF clone of Human RAD51 homolog (S. cerevisiae) (RAD51), transcript variant 1, Myc-DDK-tagged |
CNY 7888.00 |
|
| RC218333L4 | Lenti ORF clone of Human RAD51 homolog (S. cerevisiae) (RAD51), transcript variant 1, mGFP tagged |
CNY 7888.00 |
|
| RG218333 | RAD51 (tGFP-tagged) - Human RAD51 homolog (S. cerevisiae) (RAD51), transcript variant 1 |
CNY 7088.00 |
