GNG7 (NM_052847) Human Untagged Clone

CAT#: SC309302

GNG7 (untagged)-Human guanine nucleotide binding protein (G protein), gamma 7 (GNG7)



  "NM_052847" in other vectors (6)

CNY 1200.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
GNG7 mouse monoclonal antibody, clone OTI3G1 (formerly 3G1)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_052847, the custom clone sequence may differ by one or more nucleotides


ATGTCAGCCACTAACAACATAGCCCAGGCCCGGAAGCTGGTGGAACAGCTACGCATAGAAGCCGGGATTG
AGCGCATCAAGGTCTCCAAAGCGGCGTCTGACCTCATGAGCTACTGTGAGCAACATGCCCGGAACGACCC
CCTGCTGGTCGGAGTCCCTGCCTCGGAGAACCCCTTTAAGGACAAGAAACCTTGTATTATTTTATAA


Restriction Sites Please inquire     
ACCN NM_052847
Insert Size 1000 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_052847.1, NP_443079.1
RefSeq Size 4175 bp
RefSeq ORF 207 bp
Locus ID 2788
UniProt ID O60262
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway
Gene Summary Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction. Plays a role in the regulation of adenylyl cyclase signaling in certain regions of the brain. Plays a role in the formation or stabilzation of a G protein heterotrimer (G(olf) subunit alpha-beta-gamma-7) that is required for adenylyl cyclase activity in the striatum (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...