BAGE2 (NM_182482) Human Untagged Clone
CAT＃: SC309314
BAGE2 (untagged)-Human B melanoma antigen family, member 2 (BAGE2)
CNY 1200.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CT2.2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_182482 edited
ATGGTGGTGGCAACAGAGATGGCAGCGCAGCTGGAGTGTTAGGAGGGCGGCCTGAGCGGT AGGAGTGGGGCTGGAGCAGTAAGATGGCGGCCGGAGCAGTAAGATGGCGGCTGGAGTGGT TTTTCTGGCATTGTCTGCCCAGCTGCTCCAAGCCAGGCTGATGAAGGAGGAGTCCCCTGT GGTGAGCTGGAGGTTGGAGCCTGAAGATGGCACAGCTCTCGATGTGCATTTTGTAAGCAC TTTGGAGCCACTATCAAATGCTGTGAAGAGAAATGTACCCAGATGTATCATTATCCTTGT GCTGCAGGAGCCGACACCTTTCAGGATTTCAGTCACATCTTCCTGCTTTGTCCAGAACAC ATTGACCAAGCTCCTGAAAGATCGAAGGAAGATGCAAACTGTGCAGTGTGCGACAGCCCG GGAGACCTCTTAGATCAGTTCTTTTGTACTACTTGTGGTCAGCACTATCATGGAATGTGC CTGGATATAGCGGTTACTCCATTAAAACGTGCAGGTTGGCAATGTCCTGAGTGCAAAGTG TGCCAGAACTGCAAACAATCGGGAGAAGATAGCAAGATGCTAGTGTGTGATACGTGTGAC AAAT |
| Restriction Sites | Please inquire |
| ACCN | NM_182482 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_182482.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_182482.1, NP_872288.1 |
| RefSeq Size | 1891 bp |
| RefSeq ORF | 330 bp |
| Locus ID | 85319 |
| Protein Families | Druggable Genome |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219432 | BAGE2 (Myc-DDK-tagged)-Human B melanoma antigen family, member 2 (BAGE2) |
CNY 1200.00 |
|
| RC219432L3 | Lenti ORF clone of Human B melanoma antigen family, member 2 (BAGE2), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC219432L4 | Lenti ORF clone of Human B melanoma antigen family, member 2 (BAGE2), mGFP tagged |
CNY 5890.00 |
|
| RG219432 | BAGE2 (tGFP-tagged) - Human B melanoma antigen family, member 2 (BAGE2) |
CNY 4370.00 |
