SNRPB2 (NM_198220) Human Untagged Clone
CAT#: SC309367
SNRPB2 (untagged)-Human small nuclear ribonucleoprotein polypeptide B (SNRPB2), transcript variant 2
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Msl1; U2B' |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC309367 representing NM_198220.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGATATCAGACCAAATCATACAATTTATATCAACAATATGAATGACAAAATTAAAAAGGAAGAATTG AAGAGATCCCTATATGCCCTGTTTTCTCAGTTTGGTCATGTGGTGGACATTGTGGCTTTAAAGACCATG AAGATGAGGGGGCAGGCCTTTGTCATATTTAAGGAACTGGGCTCATCCACAAATGCCTTGAGACAGCTA CAAGGATTTCCATTTTATGGTAAACCAATGCGAATACAGTATGCAAAAACAGATTCGGATATAATATCA AAAATGCGTGGAACTTTTGCTGACAAAGAAAAGAAAAAAGAAAAGAAAAAAGCCAAAACTGTGGAACAG ACTGCAACAACCACAAACAAAAAGCCTGGCCAGGGAACTCCAAATTCAGCTAATACCCAAGGAAATTCA ACACCAAATCCTCAGGTCCCTGATTACCCTCCAAACTATATTTTATTCCTTAATAACTTACCAGAAGAG ACTAATGAGATGATGTTATCCATGCTGTTTAATCAGTTCCCTGGCTTCAAGGAAGTACGTCTGGTACCA GGGAGGCATGACATTGCTTTTGTTGAATTTGAAAATGATGGGCAGGCTGGAGCTGCCAGGGATGCTTTA CAGGGATTTAAGATCACACCGTCCCATGCTATGAAGATCACCTATGCCAAGAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_198220 |
| Insert Size | 678 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_198220.2 |
| RefSeq Size | 1592 bp |
| RefSeq ORF | 678 bp |
| Locus ID | 6629 |
| UniProt ID | P08579 |
| Protein Pathways | Spliceosome |
| MW | 25.5 kDa |
| Gene Summary | The protein encoded by this gene associates with stem loop IV of U2 small nuclear ribonucleoprotein (U2 snRNP) in the presence of snRNP-A'. The encoded protein may play a role in pre-mRNA splicing. Autoantibodies from patients with systemic lupus erythematosus frequently recognize epitopes on the encoded protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC207603 | SNRPB2 (Myc-DDK-tagged)-Human small nuclear ribonucleoprotein polypeptide B (SNRPB2), transcript variant 2 |
CNY 2400.00 |
|
| RC207603L3 | Lenti ORF clone of Human small nuclear ribonucleoprotein polypeptide B (SNRPB2), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC207603L4 | Lenti ORF clone of Human small nuclear ribonucleoprotein polypeptide B (SNRPB2), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG207603 | SNRPB2 (tGFP-tagged) - Human small nuclear ribonucleoprotein polypeptide B (SNRPB2), transcript variant 2 |
CNY 4000.00 |
