DERL3 (NM_198440) Human Untagged Clone
CAT#: SC309375
DERL3 (untagged)-Human Der1-like domain family, member 3 (DERL3), transcript variant 3
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C22orf14; derlin-3; IZP6; LLN2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC309375 representing NM_198440.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGTGGCAGGGACTAGCGGCCGAGTTCCTGCAGGTGCCGGCGGTGACGCGGGCTTACACCGCAGCC TGTGTCCTCACCACCGCCGCGGTGCAGCTGGAGCTCCTCAGCCCCTTTCAACTCTACTTCAACCCGCAC CTTGTGTTCCGGAAGTTCCAGGTCTGGAGGCTCGTCACCAACTTCCTCTTCTTCGGGCCCCTGGGATTC AGCTTCTTCTTCAACATGCTCTTCGTGTTCCGCTACTGCCGCATGCTGGAAGAGGGCTCCTTCCGCGGC CGCACGGCCGACTTCGTCTTCATGTTTCTCTTCGGGGGCGTCCTTATGACCCTGCTGGGACTCCTGGGC AGCCTGTTCTTCCTGGGCCAGGCCCTCATGGCCATGCTGGTGTACGTGTGGAGCCGCCGCAGCCCTCGG GTGAGGGTCAACTTCTTCGGCCTGCTCACTTTCCAGGCACCGTTCCTGCCTTGGGCGCTCATGGGCTTC TCGCTGCTGCTGGGCAACTCCATCCTCGTGGACCTGCTGGGGATTGCGGTGGGCCATATCTACTACTTC CTGGAGGACGTCTTCCCCAACCAGCCTGGAGGCAAGAGGCTCCTGCAGACCCCTGGCTTCCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_198440 |
| Insert Size | 618 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_198440.3 |
| RefSeq Size | 3216 bp |
| RefSeq ORF | 618 bp |
| Locus ID | 91319 |
| UniProt ID | Q96Q80 |
| Protein Families | Transmembrane |
| MW | 23.4 kDa |
| Gene Summary | The protein encoded by this gene belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in the degradation of misfolded glycoproteins in the ER. Several alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (3) contains a long 3' terminal exon that is split into 2 exons in transcript variant 1. This results in early translation termination and a shorter isoform (3) compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no quality transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216060 | DERL3 (Myc-DDK-tagged)-Human Der1-like domain family, member 3 (DERL3), transcript variant 3 |
CNY 2400.00 |
|
| RC216060L3 | Lenti ORF clone of Human Der1-like domain family, member 3 (DERL3), transcript variant 3, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC216060L4 | Lenti ORF clone of Human Der1-like domain family, member 3 (DERL3), transcript variant 3, mGFP tagged |
CNY 5890.00 |
|
| RG216060 | DERL3 (tGFP-tagged) - Human Der1-like domain family, member 3 (DERL3), transcript variant 3 |
CNY 4370.00 |
