SETD7 (NM_030648) Human Untagged Clone
CAT#: SC310486
SETD7 (untagged)-Human SET domain containing (lysine methyltransferase) 7 (SETD7)
CNY 5,488.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | KMT7; SET7; SET7/9; SET9 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_030648, the custom clone sequence may differ by one or more nucleotides
ATGGATAGCGACGACGAGATGGTGGAGGAGGCGGTGGAAGGGCACCTGGACGATGACGGATTACCGCACG GGTTCTGCACAGTCACCTACTCCTCCACAGACAGATTTGAGGGGAACTTTGTTCACGGAGAAAAGAACGG ACGGGGGAAGTTCTTCTTCTTTGATGGCAGCACCCTGGAGGGGTATTATGTGGATGATGCCTTGCAGGGC CAGGGAGTTTACACTTACGAAGATGGGGGAGTTCTCCAGGGCACGTATGTAGACGGAGAGCTGAACGGTC CAGCCCAGGAATATGACACAGATGGGAGACTGATCTTCAAGGGGCAGTATAAAGATAACATTCGTCATGG AGTGTGCTGGATATATTACCCAGATGGAGGAAGCCTTGTAGGAGAAGTAAATGAAGATGGGGAGATGACT GGAGAGAAGATAGCCTATGTGTACCCTGATGAGAGGACCGCACTTTATGGGAAATTTATTGATGGAGAGA TGATAGAAGGCAAACTGGCTACCCTTATGTCCACTGAAGAAGGGAGGCCTCACTTTGAACTGATGCCTGG AAATTCAGTGTACCACTTTGATAAGTCGACTTCATCTTGCATTTCTACCAATGCTCTTCTTCCAGATCCT TATGAATCAGAAAGGGTTTATGTTGCTGAATCTCTTATTTCCAGTGCTGGAGAAGGACTTTTTTCAAAGG TAGCTGTGGGACCTAATACTGTTATGTCTTTTTATAATGGAGTTCGAATTACACACCAAGAGGTTGACAG CAGGGACTGGGCCCTTAATGGGAACACCCTCTCCCTTGATGAAGAAACGGTCATTGATGTGCCTGAGCCC TATAACCACGTATCCAAGTACTGTGCCTCCTTGGGACACAAGGCAAATCACTCCTTCACTCCAAACTGCA TCTACGATATGTTTGTCCACCCCCGTTTTGGGCCCATCAAATGCATCCGCACCCTGAGAGCAGTGGAGGC CGATGAAGAGCTCACCGTTGCCTATGGCTATGACCACAGCCCCCCCGGGAAGAGTGGGCCTGAAGCCCCT GAGTGGTACCAGGTGGAGCTGAAGGCCTTCCAGGCCACCCAGCAAAAGTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_030648 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_030648.2, NP_085151.1 |
RefSeq Size | 7012 bp |
RefSeq ORF | 1101 bp |
Locus ID | 80854 |
UniProt ID | Q8WTS6 |
Domains | SET, MORN |
Protein Families | Druggable Genome |
Protein Pathways | Lysine degradation |
Gene Summary | Histone methyltransferase that specifically monomethylates 'Lys-4' of histone H3. H3 'Lys-4' methylation represents a specific tag for epigenetic transcriptional activation. Plays a central role in the transcriptional activation of genes such as collagenase or insulin. Recruited by IPF1/PDX-1 to the insulin promoter, leading to activate transcription. Has also methyltransferase activity toward non-histone proteins such as p53/TP53, TAF10, and possibly TAF7 by recognizing and binding the [KR]-[STA]-K in substrate proteins. Monomethylates 'Lys-189' of TAF10, leading to increase the affinity of TAF10 for RNA polymerase II. Monomethylates 'Lys-372' of p53/TP53, stabilizing p53/TP53 and increasing p53/TP53-mediated transcriptional activation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219244 | SETD7 (Myc-DDK-tagged)-Human SET domain containing (lysine methyltransferase) 7 (SETD7) |
CNY 5,488.00 |
|
RC219244L1 | Lenti ORF clone of Human SET domain containing (lysine methyltransferase) 7 (SETD7), Myc-DDK-tagged |
CNY 7,888.00 |
|
RC219244L2 | Lenti ORF clone of Human SET domain containing (lysine methyltransferase) 7 (SETD7), mGFP tagged |
CNY 5,890.00 |
|
RC219244L3 | Lenti ORF clone of Human SET domain containing (lysine methyltransferase) 7 (SETD7), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219244L4 | Lenti ORF clone of Human SET domain containing (lysine methyltransferase) 7 (SETD7), mGFP tagged |
CNY 5,890.00 |
|
RG219244 | SETD7 (tGFP-tagged) - Human SET domain containing (lysine methyltransferase) 7 (SETD7) |
CNY 7,088.00 |