RNF146 (NM_030963) Human Untagged Clone
CAT#: SC310503
RNF146 (untagged)-Human ring finger protein 146 (RNF146)
CNY 3656.00
CNY 7220.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_030963 edited
ATGGCTGGCTGTGGTGAAATTGATCATTCAATAAACATGCTTCCTACAAACAGGAAAGCG AACGAGTCCTGTTCTAATACTGCACCTTCTTTAACCGTCCCTGAATGTGCCATTTGTCTG CAAACATGTGTTCATCCAGTCAGTCTGCCCTGTAAGCACGTTTTCTGCTATCTATGTGTA AAAGGAGCTTCATGGCTTGGAAAGCGGTGTGCTCTTTGTCGACAAGAAATTCCCGAGGAT TTCCTTGACAAGCCAACCTTGTTGTCACCAGAAGAACTCAAGGCAGCAAGTAGAGGAAAT GGTGAATATGCATGGTATTATGAAGGAAGAAATGGGTGGTGGCAGTACGATGAGCGCACT AGTAGAGAGCTGGAAGATGCTTTTTCCAAAGGTAAAAAGAACACTGAAATGTTAATTGCT GGCTTTCTGTATGTCGCTGATCTTGAAAACATGGTTCAATATAGGAGAAATGAACATGGA CGTCGCAGGAAGATTAAGCGAGATATAATAGATATACCAAAGAAGGGAGTAGCTGGACTT AGGCTAGACTGTGATGCTAATACCGTAAACCTAGCAAGAGAGAGCTCTGCTGACGGAGCG GACAGTGTATCAGCACAGAGTGGAGCTTCTGTTCAGCCCCTAGTGTCTTCTGTAAGGCCC CTAACATCAGTAGATGGTCAGTTAACAAGCCCTGCAACACCATCCCCTGATGCAAGCACT TCTCTGGAAGACTCTTTTGCTCATTTACAACTCAGTGGAGACAACACAGCTGAAAGGAGT CATAGGGGAGAAGGAGAAGAAGATCATGAATCACCATCTTCAGGCAGGGTACCAGCACCA GACACCTCCATTGAAGAAACTGAATCAGATGCCAGTAGTGATAGTGAGGATGTATCTGCA GTTGTTGCACAGCACTCCTTGACCCAACAGAGACTTTTGGTTTCTAATGCAAACCAGACA GTACCCGATCGATCAGATCGATCGGGAACTGATCGATCAGTAGCAGGGGGTGGAACAGTG AGTGTCAGTGTCAGATCTAGAAGGCCTGATGGACAGTGCACAGTAACTGAAGTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_030963 |
Insert Size | 2300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_030963.2, NP_112225.2 |
RefSeq Size | 2158 bp |
RefSeq ORF | 1077 bp |
Locus ID | 81847 |
UniProt ID | Q9NTX7 |
Domains | RING, WWE |
Protein Families | Druggable Genome |
Gene Summary | E3 ubiquitin-protein ligase that specifically binds poly-ADP-ribosylated (PARsylated) proteins and mediates their ubiquitination and subsequent degradation. May regulate many important biological processes, such as cell survival and DNA damage response. Acts as an activator of the Wnt signaling pathway by mediating the ubiquitination of PARsylated AXIN1 and AXIN2, 2 key components of the beta-catenin destruction complex. Acts in cooperation with tankyrase proteins (TNKS and TNKS2), which mediate PARsylation of target proteins AXIN1, AXIN2, BLZF1, CASC3, TNKS and TNKS2. Recognizes and binds tankyrase-dependent PARsylated proteins via its WWE domain and mediates their ubiquitination, leading to their degradation. Different ubiquitin linkage types have been observed: TNKS2 undergoes ubiquitination at 'Lys-48' and 'Lys-63', while AXIN1 is only ubiquitinated at 'Lys-48'. May regulate TNKS and TNKS2 subcellular location, preventing aggregation at a centrosomal location. Neuroprotective protein. Protects the brain against N-methyl-D-aspartate (NMDA) receptor-mediated glutamate excitotoxicity and ischemia, by interfering with PAR-induced cell death, called parthanatos. Prevents nuclear translocation of AIFM1 in a PAR-binding dependent manner. Does not affect PARP1 activation (By similarity). Protects against cell death induced by DNA damaging agents, such as N-methyl-N-nitro-N-nitrosoguanidine (MNNG) and rescues cells from G1 arrest. Promotes cell survival after gamma-irradiation. Facilitates DNA repair.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1-7 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202306 | RNF146 (Myc-DDK-tagged)-Human ring finger protein 146 (RNF146) |
CNY 3656.00 |
|
RC202306L1 | Lenti ORF clone of Human ring finger protein 146 (RNF146), Myc-DDK-tagged |
CNY 6056.00 |
|
RC202306L2 | Lenti ORF clone of Human ring finger protein 146 (RNF146), mGFP tagged |
CNY 5890.00 |
|
RC202306L3 | Lenti ORF clone of Human ring finger protein 146 (RNF146), Myc-DDK-tagged |
CNY 5890.00 |
|
RC202306L4 | Lenti ORF clone of Human ring finger protein 146 (RNF146), mGFP tagged |
CNY 5890.00 |
|
RG202306 | RNF146 (tGFP-tagged) - Human ring finger protein 146 (RNF146) |
CNY 5256.00 |