GPRC5D (NM_018654) Human Untagged Clone
CAT#: SC310520
GPRC5D (untagged)-Human G protein-coupled receptor, family C, group 5, member D (GPRC5D)
CNY 3656.00
CNY 5610.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | PCMV6-Neo |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_018654 edited
ATGTACAAGGACTGCATCGAGTCCACTGGAGACTATTTTCTTCTCTGTGACGCCGAGGGG CCATGGGGCATCATTCTGGAGTCCCTGGCCATACTTGGCATCGTGGTCACAATTCTGCTA CTCTTAGCATTTCTCTTCCTCATGCGAAAGATCCAAGACTGCAGCCAGTGGAATGTCCTC CCCACCCAGCTCCTCTTCCTCCTGAGTGTCCTGGGGCTCTTCGGACTCGCTTTTGCCTTC ATCATCGAGCTCAATCAACAAACTGCCCCCGTACGCTACTTTCTCTTTGGGGTTCTCTTT GCTCTCTGTTTCTCATGCCTCTTAGCTCATGCCTCCAATCTAGTGAAGCTGGTTCGGGGT TGTGTCTCCTTCTCCTGGACGACAATTCTGTGCATTGCTATTGGTTGCAGTCTGTTGCAA ATCATTATTGCCACTGAGTATGTGACTCTCATCATGACCAGAGGTATGATGTTTGTGAAT ATGACACCCTGCCAGCTCAATGTGGACTTTGTTGTACTCCTGGTCTATGTCCTCTTCCTG ATGGCCCTCACATTCTTCGTCTCCAAAGCCACCTTCTGTGGCCCGTGTGAGAACTGGAAG CAGCATGGAAGGCTCATCTTTATCACTGTGCTCTTCTCCATCATCATCTGGGTGGTGTGG ATCTCCATGCTCCTGAGAGGCAACCCGCAGTTCCAGCGACAGCCCCAGTGGGATGACCCG GTCGTCTGCATTGCTCTGGTCACCAACGCATGGGTTTTCCTGCTGCTGTACATCGTCCCT GAGCTCTGCATTCTCTACAGATCGTGTAGACAGGAGTGCCCTTTACAAGGCAATGCCTGC CCCGTCACAGCCTACCAACACAGCTTCCAAGTGGAGAACCAGGAGCTCTCCAGAGCCCGA GACAGTGATGGAGCTGAGGAGGATGTAGCATTAACTTCATATGGTACTCCCATTCAGCCG CAGACTGTTGATCCCACACAAGAGTGTTTCATCCCACAGGCTAAACTAAGCCCCCAGCAA GATGCAGGAGGAGTATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_018654 |
| Insert Size | 1000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_018654.1, NP_061124.1 |
| RefSeq Size | 1038 bp |
| RefSeq ORF | 1038 bp |
| Locus ID | 55507 |
| UniProt ID | Q9NZD1 |
| Protein Families | Druggable Genome, GPCR, Transmembrane |
| Gene Summary | The protein encoded by this gene is a member of the G protein-coupled receptor family; however, the specific function of this gene has not yet been determined. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC210138 | GPRC5D (Myc-DDK-tagged)-Human G protein-coupled receptor, family C, group 5, member D (GPRC5D) |
CNY 3656.00 |
|
| RC210138L3 | Lenti ORF clone of Human G protein-coupled receptor, family C, group 5, member D (GPRC5D), Myc-DDK-tagged |
CNY 6056.00 |
|
| RC210138L4 | Lenti ORF clone of Human G protein-coupled receptor, family C, group 5, member D (GPRC5D), mGFP tagged |
CNY 6056.00 |
|
| RG210138 | GPRC5D (tGFP-tagged) - Human G protein-coupled receptor, family C, group 5, member D (GPRC5D) |
CNY 5256.00 |
