BCCIP (NM_016567) Human Untagged Clone

CAT#: SC310535

BCCIP (untagged)-Human BRCA2 and CDKN1A interacting protein (BCCIP), transcript variant A



  "NM_016567" in other vectors (6)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit polyclonal antibody to TOK-1 alpha (BRCA2 and CDKN1A interacting protein)
    • 100 ul

CNY 6281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms TOK-1; TOK1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310535 representing NM_016567.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGTCCAGGTCTAAGCGGCGTGCCGTGGAAAGTGGGGTTCCGCAGCCGCCGGATCCCCCAGTCCAG
CGCGACGAGGAAGAGGAAAAAGAAGTCGAAAATGAGGATGAAGACGATGATGACAGTGACAAGGAAAAG
GATGAAGAGGACGAGGTCATTGACGAGGAAGTGAATATTGAATTTGAAGCTTATTCCCTATCAGATAAT
GATTATGACGGAATTAAGAAATTACTGCAGCAGCTTTTTCTAAAGGCTCCTGTGAACACTGCAGAACTA
ACAGATCTCTTAATTCAACAGAACCATATTGGGAGTGTGATTAAGCAAACGGATGTTTCAGAAGACAGC
AATGATGATATGGATGAAGATGAGGTTTTTGGTTTCATAAGCCTTTTAAATTTAACTGAAAGAAAGGGT
ACCCAGTGTGTTGAACAAATTCAAGAGTTGGTTCTACGCTTCTGTGAGAAGAACTGTGAAAAGAGCATG
GTTGAACAGCTGGACAAGTTTTTAAATGACACCACCAAGCCTGTGGGCCTTCTCCTAAGTGAAAGATTC
ATTAATGTCCCTCCACAGATCGCTCTGCCCATGTACCAGCAGCTTCAGAAAGAACTGGCGGGGGCACAC
AGAACCAATAAGCCATGTGGGAAGTGCTACTTTTACCTTCTGATTAGTAAGACATTTGTGGAAGCAGGA
AAAAACAATTCCAAAAAGAAACCTAGCAACAAAAAGAAAGCTGCGTTAATGTTTGCAAATGCAGAGGAA
GAATTTTTCTATGAGGAGCAGGGAAAACCTGAGGTGCTTGGAGGTCCAGACACAAGAAGAGGATTGGAA
CCAGTTCCGATACAGCACAATGGTGGTTCACGGGGGCAAGTGACAGCCCTGGTTTCTCTGAAGGCTGGA
CTAATTCAATCAAGATCAACTCTAAGTGATTTCCAGGGAACCTTCATGACTGTTGGAATTGCTCTGTCA
TAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_016567
Insert Size 969 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_016567.3
RefSeq Size 1461 bp
RefSeq ORF 969 bp
Locus ID 56647
UniProt ID Q9P287
Protein Families Druggable Genome, Stem cell - Pluripotency
MW 36.2 kDa
Gene Summary This gene product was isolated on the basis of its interaction with BRCA2 and p21 proteins. It is an evolutionarily conserved nuclear protein with multiple interacting domains. The N-terminal half shares moderate homology with regions of calmodulin and M-calpain, suggesting that it may also bind calcium. Functional studies indicate that this protein may be an important cofactor for BRCA2 in tumor suppression, and a modulator of CDK2 kinase activity via p21. This protein has also been implicated in the regulation of BRCA2 and RAD51 nuclear focus formation, double-strand break-induced homologous recombination, and cell cycle progression. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (A) encodes the longest isoform (BCCIPalpha, which is also known as TOK-1alpha). BCCIPalpha has a different C-terminus compared to isoforms BCCIPbeta and C, and has been the subject of most functional studies.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...