CA5B (NM_007220) Human Untagged Clone

CAT#: SC310537

CA5B (untagged)-Human carbonic anhydrase VB, mitochondrial (CA5B), nuclear gene encoding mitochondrial protein



  "NM_007220" in other vectors (6)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CA5B Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CA-VB; CAVB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310537 representing NM_007220.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTA
CCGAGGAGATCTGCCGCCGCGATCGCCGGCGCGCCC
ATGGTGGTGATGAACAGCCTGAGGGTCATTCTTCAAGCCTCTCCAGGCAAATTGCTGTGGAGAAAGTTC
CAGATTCCGAGATTCATGCCAGCGAGGCCCTGCAGCCTCTATACTTGTACTTACAAAACCCGGAACCGA
GCCTTGCATCCACTCTGGGAGAGCGTGGACCTGGTTCCTGGGGGCGATCGCCAGTCACCCATCAACATT
CGGTGGAGGGACAGTGTTTATGATCCCGGCTTAAAACCACTGACCATCTCTTATGACCCAGCCACCTGC
CTCCACGTCTGGAATAATGGGTACTCTTTCCTCGTGGAATTTGAAGATTCTACAGATAAATCAGTGATC
AAGGGAGGACCCCTGGAACACAACTACCGATTGAAGCAGTTCCATTTTCACTGGGGGGCCATCGATGCC
TGGGGTTCTGAGCACACCGTGGACAGCAAATGCTTCCCAGCAGAGCTGCACTTAGTGCATTGGAACGCA
GTCAGATTTGAAAACTTTGAGGATGCAGCACTGGAAGAAAATGGTTTGGCTGTGATAGGAGTATTTTTA
AAGCTAGGCAAACATCATAAGGAGCTACAGAAATTAGTGGATACTTTGCCGTCAATTAAGCATAAGGAC
GCCCTTGTGGAATTTGGGTCATTTGACCCTTCCTGCCTGATGCCTACCTGCCCAGATTACTGGACCTAC
TCAGGGTCTCTGACTACCCCACCCCTCTCCGAGTCTGTCACCTGGATCATTAAGAAGCAACCAGTAGAG
GTTGATCATGATCAGCTTGAGCAATTTCGGACCCTGCTTTTCACTTCCGAAGGGGAGAAAGAGAAAAGA
ATGGTGGACAACTTCCGCCCCCTTCAGCCACTGATGAATCGCACTGTTCGTTCATCCTTCCGGCATGAT
TATGTGCTGAATGTACAAGCGAAACCCAAGCCGGCCACCAGCCAAGCAACCCCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites AscI-MluI     
ACCN NM_007220
Insert Size 954 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_007220.3
RefSeq Size 6032 bp
RefSeq ORF 954 bp
Locus ID 11238
UniProt ID Q9Y2D0
Domains carb_anhydrase
Protein Families Druggable Genome
Protein Pathways Nitrogen metabolism
MW 36.4 kDa
Gene Summary Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This gene encodes carbonic anhydrase 5B. CA5B, and the related CA5A gene, has its expression localized in the mitochondria though CA5B has a wider tissue distribution than CA5A, which is restricted to the liver, kidneys, and skeletal muscle. A carbonic anhydrase pseudogene (CA5BP1) is adjacent to the CA5B gene and these two loci produce CA5BP1-CA5B readthrough transcripts. [provided by RefSeq, Jan 2019]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...