QPRT (NM_014298) Human Untagged Clone
CAT#: SC310560
QPRT (untagged)-Human quinolinate phosphoribosyltransferase (QPRT)
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HEL-S-90n; QPRTase |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310560 representing NM_014298.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACGCTGAAGGCCTGGCGCTGCTGCTGCCGCCCGTCACCCTGGCAGCCCTGGTGGACAGCTGGCTC CGAGAGGACTGCCCAGGGCTCAACTACGCAGCCTTGGTCAGCGGGGCAGGCCCCTCGCAGGCGGCGCTG TGGGCCAAATCCCCTGGGGTACTGGCAGGGCAGCCTTTCTTCGATGCCATATTTACCCAACTCAACTGC CAAGTCTCCTGGTTCCTCCCCGAGGGATCGAAGCTGGTGCCGGTGGCCAGAGTGGCCGAGGTCCGGGGC CCTGCCCACTGCCTGCTGCTGGGGGAACGGGTGGCCCTCAACACGCTGGCCCGCTGCAGTGGCATTGCC AGTGCTGCCGCCGCTGCAGTGGAGGCCGCCAGGGGGGCCGGCTGGACTGGGCACGTGGCAGGCACGAGG AAGACCACGCCAGGCTTCCGGCTGGTGGAGAAGTATGGGCTCCTGGTGGGCGGGGCCGCCTCGCACCGC TACGACCTGGGAGGGCTGGTGATGGTGAAGGATAACCATGTGGTGGCCGCCGGTGGCGTGGAGAAGGCG GTGCGGGCGGCCAGACAGGCGGCTGACTTCGCTCTGAAGGTGGAAGTGGAATGCAGCAGCCTGCAGGAG GCCGTGCAGGCAGCTGAGGCTGGTGCCGACCTTGTCCTGCTGGACAACTTCAAGCCAGAGGAGCTGCAC CCCACGGCCACCGTGCTGAAGGCCCAGTTCCCGAGTGTGGCTGTGGAAGCCAGTGGGGGCATCACCCTG GACAACCTCCCCCAGTTCTGCGGGCCGCACATAGACGTCATCTCCATGGGGATGCTGACCCAGGCGGCC CCAGCCCTTGATTTCTCCCTCAAGCTGTTTGCCAAAGAGGTGGCTCCAGTGCCCAAAATCCACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_014298 |
Insert Size | 894 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014298.4 |
RefSeq Size | 2385 bp |
RefSeq ORF | 894 bp |
Locus ID | 23475 |
UniProt ID | Q15274 |
Domains | QRPTase |
Protein Pathways | Metabolic pathways, Nicotinate and nicotinamide metabolism |
MW | 30.8 kDa |
Gene Summary | This gene encodes a key enzyme in catabolism of quinolinate, an intermediate in the tryptophan-nicotinamide adenine dinucleotide pathway. Quinolinate acts as a most potent endogenous exitotoxin to neurons. Elevation of quinolinate levels in the brain has been linked to the pathogenesis of neurodegenerative disorders such as epilepsy, Alzheimer's disease, and Huntington's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202960 | QPRT (Myc-DDK-tagged)-Human quinolinate phosphoribosyltransferase (QPRT) |
CNY 3,600.00 |
|
RC202960L1 | Lenti ORF clone of Human quinolinate phosphoribosyltransferase (QPRT), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC202960L2 | Lenti ORF clone of Human quinolinate phosphoribosyltransferase (QPRT), mGFP tagged |
CNY 5,890.00 |
|
RC202960L3 | Lenti ORF clone of Human quinolinate phosphoribosyltransferase (QPRT), Myc-DDK-tagged |
CNY 6,000.00 |
|
RC202960L4 | Lenti ORF clone of Human quinolinate phosphoribosyltransferase (QPRT), mGFP tagged |
CNY 6,000.00 |
|
RG202960 | QPRT (tGFP-tagged) - Human quinolinate phosphoribosyltransferase (QPRT) |
CNY 5,200.00 |
|
SC319149 | QPRT (untagged)-Human quinolinate phosphoribosyltransferase (QPRT) |
CNY 3,600.00 |