RBM38 (NM_017495) Human Untagged Clone

CAT#: SC310609

RBM38 (untagged)-Human RNA binding motif protein 38 (RBM38), transcript variant 1



  "NM_017495" in other vectors (4)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-RBM38 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dJ800J21.2; HSRNASEB; RNPC1; SEB4B; SEB4D
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_017495 edited
ATGCTGCTGCAGCCCGCGCCGTGCGCCCCGAGCGCGGGCTTCCCGCGGCCCCTGGCCGCC
CCCGGCGCCATGCACGGCTCGCAGAAGGACACCACGTTCACCAAGATCTTCGTGGGCGGC
CTGCCGTACCACACTACCGACGCCTCGCTCAGGAAGTACTTCGAGGGCTTCGGCGACATC
GAGGAGGCCGTGGTCATCACCGACCGCCAGACGGGCAAGTCCCGCGGCTACGGCTTCGTG
ACCATGGCCGACCGGGCGGCAGCTGAGAGGGCTTGCAAAGACCCGAACCCCATCATCGAC
GGCCGCAAGGCCAACGTGAACCTGGCATATCTGGGCGCCAAGCCGCGGAGCCTCCAGACG
GGCTTTGCCATTGGGGTGCAGCAGCTGCACCCCACCTTGATCCAGCGGACTTACGGGCTG
ACCCCGCACTACATCTACCCACCAGCCATCGTGCAGCCCAGCGTGGTGATCCCAGCCGCC
CCTGTCCCGTCGCTGTCCTCGCCCTACATTGAGTACACGCCGGCCAGCCCGGCCTACGCC
CAGTACCCACCGGCCACCTATGACCAGTACCCATACGCCGCCTCGCCTGCCACGGCTGCC
AGCTTCGTGGGCTACAGCTACCCTGCCGCCGTGCCCCAGGCCCTCTCAGCCGCAGCACCC
GCGGGCACCACTTTCGTGCAGTACCAGGCGCCGCAGCTGCAGCCTGACAGGATGCAGTGA
Restriction Sites NotI-NotI     
ACCN NM_017495
Insert Size 2500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_017495.4, NP_059965.2
RefSeq Size 2401 bp
RefSeq ORF 720 bp
Locus ID 55544
UniProt ID Q9H0Z9
Domains RRM
Gene Summary RNA-binding protein that specifically bind the 3' UTR of CDKN1A transcripts, leading to maintain the stability of CDKN1A transcripts, thereby acting as a mediator of the p53/TP53 family to regulate CDKN1A. CDKN1A is a cyclin-dependent kinase inhibitor transcriptionally regulated by the p53/TP53 family to induce cell cycle arrest. Isoform 1, but not isoform 2, has the ability to induce cell cycle arrest in G1 and maintain the stability of CDKN1A transcripts induced by p53/TP53. Also acts as a mRNA splicing factor. Specifically regulates the expression of FGFR2-IIIb, an epithelial cell-specific isoform of FGFR2. Plays a role in myogenic differentiation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) lacks an alternate in-frame exon in the 5' coding region, compared to variant 3, resulting in an isoform (a) that is shorter than isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...