PAX3 (NM_000438) Human Untagged Clone
CAT#: SC310622
PAX3 (untagged)-Human paired box 3 (PAX3), transcript variant PAX3A
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CDHS; HUP2; WS1; WS3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_000438, the custom clone sequence may differ by one or more nucleotides
ATGACCACGCTGGCCGGCGCTGTGCCCAGGATGATGCGGCCGGGCCCGGGGCAGAACTAC CCGCGTAGCGGGTTCCCGCTGGAAGTGTCCACTCCCCTCGGCCAGGGCCGCGTCAACCAG CTCGGCGGTGTTTTTATCAACGGCAGGCCGCTGCCCAACCACATCCGCCACAAGATCGTG GAGATGGCCCACCACGGCATCCGGCCCTGCGTCATCTCGCGCCAGCTGCGCGTGTCCCAC GGCTGCGTCTCCAAGATCCTGTGCAGGTACCAGGAGACTGGCTCCATACGTCCTGGTGCC ATCGGCGGCAGCAAGCCCAAGCAGGTGACAACGCCTGACGTGGAGAAGAAAATTGAGGAA TACAAAAGAGAGAACCCGGGCATGTTCAGCTGGGAAATCCGAGACAAATTACTCAAGGAC GCGGTCTGTGATCGAAACACCGTGCCGTCAGTGAGTTCCATCAGCCGCATCCTGAGAAGT AAATTCGGGAAAGGTGAAGAGGAGGAGGCCGACTTGGAGAGGAAGGAGGCAGAGGAAAGC GAGAAGAAGGCCAAACACAGCATCGACGGCATCCTGAGCGAGCGAGGTAAGCGGTGGCGC CTTGGGCGGCGCACTTGCTGGGTGACTTGGAGGGCATCGGCTAGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_000438 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000438.3, NP_000429.2 |
RefSeq Size | 1489 bp |
RefSeq ORF | 648 bp |
Locus ID | 5077 |
UniProt ID | P23760 |
Domains | PAX |
Protein Families | Adult stem cells, Druggable Genome, Embryonic stem cells, ES Cell Differentiation/IPS, Transcription Factors |
Gene Summary | This gene is a member of the paired box (PAX) family of transcription factors. Members of the PAX family typically contain a paired box domain and a paired-type homeodomain. These genes play critical roles during fetal development. Mutations in paired box gene 3 are associated with Waardenburg syndrome, craniofacial-deafness-hand syndrome, and alveolar rhabdomyosarcoma. The translocation t(2;13)(q35;q14), which represents a fusion between PAX3 and the forkhead gene, is a frequent finding in alveolar rhabdomyosarcoma. Alternative splicing results in transcripts encoding isoforms with different C-termini. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (PAX3A) differs in the 3' UTR, includes an alternate segment in the coding region, which causes a frameshift, and lacks several segments in the 3' coding region, compared to variant PAX3. The resulting protein (isoform PAX3a) has a shorter and distinct C-terminus, compared to isoform PAX3. Isoform PAX3a lacks the paired-type homeodomain. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222827 | PAX3 (Myc-DDK-tagged)-Human paired box 3 (PAX3), transcript variant PAX3A |
CNY 3,840.00 |
|
RC222827L3 | Lenti-ORF clone of PAX3 (Myc-DDK-tagged)-Human paired box 3 (PAX3), transcript variant PAX3A |
CNY 5,890.00 |
|
RC222827L4 | Lenti-ORF clone of PAX3 (mGFP-tagged)-Human paired box 3 (PAX3), transcript variant PAX3A |
CNY 5,890.00 |
|
RG222827 | PAX3 (tGFP-tagged) - Human paired box 3 (PAX3), transcript variant PAX3A |
CNY 4,370.00 |