Annexin VIII (ANXA8) (NM_001040084) Human Untagged Clone

CAT#: SC310952

ANXA8 (untagged)-Human annexin A8 (ANXA8)



  "NM_001040084" in other vectors (6)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-ANXA8 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ANX8; CH17-360D5.2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310952 representing NM_001040084.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCTGGTGGAAATCCTGGATTGAACAGGAGGGTGTCACAGTGAAGAGCAGCTCCCACTTCAACCCA
GACCCTGATGCAGAGACCCTCTACAAAGCCATGAAGGGGATCGGGACCAACGAGCAGGCTATCATCGAT
GTGCTCACCAAGAGAAGCAACACGCAGCGGCAGCAGATCGCCAAGTCCTTCAAGGCTCAGTTCGGCAAG
GACCTCACTGAGACCTTGAAGTCTGAGCTCAGTGGCAAGTTTGAGAGGCTCATTGTGGCCCTTATGTAC
CCGCCATACAGATACGAAGCCAAGGAGCTGCATGACGCCATGAAGGGCTTAGGAACCAAGGAGGGTGTC
ATCATTGAGATCCTGGCCTCTCGGACCAAGAACCAGCTGCGGGAGATAATGAAGGCGTATGAGGAAGAC
TATGGGTCCAGCCTGGAGGAGGACATCCAAGCAGACACAAGTGGCTACCTGGAGAGGATCCTGGTGTGC
CTCCTGCAGGGCAGCAGGGATGATGTGAGCAGCTTTGTGGACCCAGGACTGGCCCTCCAAGACGCACAG
GATCTGTATGCGGCAGGCGAGAAGATTCGTGGGACTGATGAGATGAAATTCATCACCATCCTGTGCACG
CGCAGTGCCACTCACCTGCTGAGAGTGTTTGAAGAGTATGAGAAAATTGCCAACAAGAGCATTGAGGAC
AGCATCAAGAGTGAGACCCATGGCTCACTGGAGGAGGCCATGCTCACTGTGGTGAAATGCACCCAAAAC
CTCCACAGCTACTTTGCAGAGAGACTCTACTATGCCATGAAGGGAGCAGGGACGCGTGATGGGACCCTG
ATAAGAAACATCGTTTCAAGGAGCGAGATTGACTTAAATCTTATCAAATGTCACTTCAAGAAGATGTAC
GGCAAGACCCTCAGCAGCATGATCATGGAAGACACCAGCGGTGACTACAAGAACGCCCTGCTGAGCCTG
GTGGGCAGCGACCCCTGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001040084
Insert Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001040084.2
RefSeq Size 2070 bp
RefSeq ORF 984 bp
Locus ID 653145
UniProt ID P13928
MW 36.9 kDa
Gene Summary This gene encodes a member of the annexin family of evolutionarily conserved Ca2+ and phospholipid binding proteins. The encoded protein may function as an an anticoagulant that indirectly inhibits the thromboplastin-specific complex. Overexpression of this gene has been associated with acute myelocytic leukemia. A highly similar duplicated copy of this gene is found in close proximity on the long arm of chromosome 10. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. It encodes isoform 2, which has a shorter N-terminus compared to isoform 1. An in-frame AUG is located 66 codons upstream of the annotated translation start site but was not annotated as a start site since it is not conserved and is in a weak Kozak sequence context.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...