CD68 (NM_001040059) Human Untagged Clone

CAT#: SC311078

CD68 (untagged)-Human CD68 molecule (CD68), transcript variant 2



  "NM_001040059" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CD68 mouse monoclonal antibody, clone OTI3B6 (formerly 3B6)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GP110; LAMP4; SCARD1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC311078 representing NM_001040059.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGGCTGGCTGTGCTTTTCTCGGGGGCCCTGCTGGGGCTACTGGCAGAGAGCACTGGAACAACCAGC
CACAGGACTACCAAGAGCCACAAAACCACCACTCACAGGACAACCACCACAGGCACCACCAGCCACGGA
CCCACGACTGCCACTCACAACCCCACCACCACCAGCCATGGAAACGTCACAGTTCATCCAACAAGCAAT
AGCACTGCCACCAGCCAGGGACCCTCAACTGCCACTCACAGTCCTGCCACCACTAGTCATGGAAATGCC
ACGGTTCATCCAACAAGCAACAGCACTGCCACCAGCCCAGGATTCACCAGTTCTGCCCACCCAGAACCA
CCTCCACCCTCTCCGAGTCCTAGCCCAACCTCCAAGGAGACCATTGGAGACTACACGTGGACCAATGGT
TCCCAGCCCTGTGTCCACCTCCAAGCCCAGATTCAGATTCGAGTCATGTACACAACCCAGGGTGGAGGA
GAGGCCTGGGGCATCTCTGTACTGAACCCCAACAAAACCAAGGTCCAGGGAAGCTGTGAGGGTGCCCAT
CCCCACCTGCTTCTCTCATTCCCCTATGGACACCTCAGCTTTGGATTCATGCAGGACCTCCAGCAGAAG
GTTGTCTACCTGAGCTACATGGCGGTGGAGTACAATGTGTCCTTCCCCCACGCAGCACAGTGGACATTC
TCGGCTCAGAATGCATCCCTTCGAGATCTCCAAGCACCCCTGGGGCAGAGCTTCAGTTGCAGCAACTCG
AGCATCATTCTTTCACCAGCTGTCCACCTCGACCTGCTCTCCCTGAGGCTCCAGGCTGCTCAGCTGCCC
CACACAGGGGTCTTTGGGCAAAGTTTCTCCTGCCCCAGTGACCGGTCCATCTTGCTGCCTCTCATCATC
GGCCTGATCCTTCTTGGCCTCCTCGCCCTGGTGCTTATTGCTTTCTGCATCATCCGGAGACGCCCATCC
GCCTACCAGGCCCTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001040059
Insert Size 984 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001040059.1
RefSeq Size 1790 bp
RefSeq ORF 984 bp
Locus ID 968
UniProt ID P34810
Protein Families Druggable Genome, Transmembrane
Protein Pathways Lysosome
MW 34.7 kDa
Gene Summary This gene encodes a 110-kD transmembrane glycoprotein that is highly expressed by human monocytes and tissue macrophages. It is a member of the lysosomal/endosomal-associated membrane glycoprotein (LAMP) family. The protein primarily localizes to lysosomes and endosomes with a smaller fraction circulating to the cell surface. It is a type I integral membrane protein with a heavily glycosylated extracellular domain and binds to tissue- and organ-specific lectins or selectins. The protein is also a member of the scavenger receptor family. Scavenger receptors typically function to clear cellular debris, promote phagocytosis, and mediate the recruitment and activation of macrophages. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region, compared to variant 1, resulting in a shorter protein (isoform B), compared to isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...