Myosin light chain kinase (MYLK) (NM_053032) Human Untagged Clone
CAT#: SC311196
MYLK (untagged)-Human myosin light chain kinase (MYLK), transcript variant 8
CNY 3990.00
Product images
 
                    
                Specifications
| Product Data | |
| Type | Human Untagged Clone | 
| Tag | Tag Free | 
| Synonyms | AAT7; KRP; MLCK; MLCK1; MLCK108; MLCK210; MMIHS; MMIHS1; MSTP083; MYLK1; smMLCK | 
| Vector | pCMV6 series | 
| Sequence Data | >NCBI ORF sequence for NM_053032, the custom clone sequence may differ by one or more nucleotides ATGGCAATGATCTCAGGGCTCAGTGGCAGGAAATCCTCAACAGGGTCACCAACCAGCCCG CTCAATGCAGAAAAACTAGAATCTGAAGAAGATGTGTCCCAAGCTTTCCTTGAGGCTGTT GCTGAGGAAAAGCCTCATGTAAAACCCTATTTCTCTAAGACCATTCGCGATTTAGAAGTT GTGGAGGGAAGTGCTGCTAGATTTGACTGCAAGATTGAAGGATACCCAGACCCCGAGGTT GTCTGGTTCAAAGATGACCAGTCAATCAGGGAGTCCCGCCACTTCCAGATAGACTACGAT GAGGACGGGAACTGCTCTTTAATTATTAGTGATGTTTGCGGGGATGACGATGCCAAGTAC ACCTGCAAGGCTGTCAACAGTCTTGGAGAAGCCACCTGCACAGCAGAGCTCATTGTGGAA ACGATGGAGGAAGGTGAAGGGGAAGGGGAAGAGGAAGAAGAGTGA | 
| Restriction Sites | Please inquire | 
| ACCN | NM_053032 | 
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). | 
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. | 
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). | 
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. | 
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. | 
| Reference Data | |
| RefSeq | NM_053032.2, NP_444260.1 | 
| RefSeq Size | 2679 bp | 
| RefSeq ORF | 465 bp | 
| Locus ID | 4638 | 
| UniProt ID | Q15746 | 
| Domains | ig | 
| Protein Families | Druggable Genome, Protein Kinase | 
| Protein Pathways | Calcium signaling pathway, Focal adhesion, Regulation of actin cytoskeleton, Vascular smooth muscle contraction | 
| Gene Summary | This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (8) encodes the longer isoform of kinase related protein, telokin. It is longer than variant 7 by one codon at the splicing junction between the first two exons. | 
Documents
| Product Manuals | 
| FAQs | 
| SDS | 
Resources
Other Versions
| SKU | Description | Size | Price | 
|---|---|---|---|
| RC216584 | MYLK (Myc-DDK-tagged)-Human myosin light chain kinase (MYLK), transcript variant 8 | CNY 3990.00 | |
| RC216584L3 | Lenti-ORF clone of MYLK (Myc-DDK-tagged)-Human myosin light chain kinase (MYLK), transcript variant 8 | CNY 5890.00 | |
| RC216584L4 | Lenti-ORF clone of MYLK (mGFP-tagged)-Human myosin light chain kinase (MYLK), transcript variant 8 | CNY 5890.00 | |
| RG216584 | MYLK (tGFP-tagged) - Human myosin light chain kinase (MYLK), transcript variant 8 | CNY 4370.00 | 
其它Myosin light chain kinase产品


 
        