United States
Germany
Japan
United Kingdom
China
Galectin 7 (LGALS7B) (NM_001042507) Human Untagged Clone
CAT＃: SC311221
LGALS7B (untagged)-Human lectin, galactoside-binding, soluble, 7B (LGALS7B)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Gal-7; GAL7; HKL-14; LGALS7; PI7 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001042507 edited
ACGGCTGCCCAACCCGGTCCCAGCCATGTCCAACGTCCCCCACAAGTCCTCACTGCCCGA GGGCATCCGCCCTGGCACGGTGCTGAGAATTCGCGGCTTGGTTCCTCCCAATGCCAGCAG GTTCCATGTAAACCTGCTGTGCGGGGAGGAGCAGGGCTCCGATGCCGCCCTGCATTTCAA CCCCCGGCTGGACACGTCGGAGGTGGTCTTCAACAGCAAGGAGCAAGGCTCCTGGGGCCG CGAGGAGCGCGGGCCGGGCGTTCCTTTCCAGCGCGGGCAGCCCTTCGAGGTGCTCATCAT CGCGTCAGACGACGGCTTCAAGGCCGTGGTTGGGGACGCCCAGTACCACCACTTCCGCCA CCGCCTGCCGCTGGCGCGCGTGCGCCTGGTGGAGGTGGGCGGGGACGTGCAGCTGGACTC CGTGAGGATCTTCTGAGCAGAAGCCCAGGCGGGCCCGGGGCCTTGGCTGGCAAATAAAGC GTTAGCCCGCAGCGCGAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001042507 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF matches with reference, NM_001042507.1 except one SNP. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001042507.1, NP_001035972.1 |
| RefSeq Size | 411 bp |
| RefSeq ORF | 411 bp |
| Locus ID | 653499 |
| UniProt ID | P47929 |
| Gene Summary | The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. Differential and in situ hybridization studies indicate that this lectin is specifically expressed in keratinocytes and found mainly in stratified squamous epithelium. A duplicate copy of this gene (GeneID:3963) is found adjacent to, but on the opposite strand on chromosome 19. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209569 | LGALS7B (Myc-DDK-tagged)-Human lectin, galactoside-binding, soluble, 7B (LGALS7B) |
CNY 1,200.00 |
|
| RC209569L3 | Lenti ORF clone of Human lectin, galactoside-binding, soluble, 7B (LGALS7B), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC209569L4 | Lenti ORF clone of Human lectin, galactoside-binding, soluble, 7B (LGALS7B), mGFP tagged |
CNY 5,890.00 |
|
| RG209569 | LGALS7B (tGFP-tagged) - Human lectin, galactoside-binding, soluble, 7B (LGALS7B) |
CNY 2,800.00 |
|
| SC322732 | LGALS7B (untagged)-Human lectin, galactoside-binding, soluble, 7B (LGALS7B) |
CNY 1,200.00 |
其它Galectin 7产品
