MYF5 (NM_005593) Human Untagged Clone

CAT#: SC311244

MYF5 (untagged)-Human myogenic factor 5 (MYF5)



  "NM_005593" in other vectors (6)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
MYF5 mouse monoclonal antibody, clone OTI2G5 (formerly 2G5)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bHLHc2; EORVA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC311244 sequence for NM_005593 edited (data generated by NextGen Sequencing)
ATGGACGTGATGGATGGCTGCCAGTTCTCACCTTCTGAGTACTTCTACGACGGCTCCTGC
ATACCGTCCCCCGAGGGTGAATTTGGGGACGAGTTTGTGCCGCGAGTGGCTGCCTTCGGA
GCGCACAAAGCAGAGCTGCAGGGCTCAGATGAGGACGAGCACGTGCGAGCGCCTACCGGC
CACCACCAGGCTGGTCACTGCCTCATGTGGGCCTGCAAAGCCTGCAAGAGGAAGTCCACC
ACCATGGATCGGCGGAAGGCAGCCACTATGCGCGAGCGGAGGCGCCTGAAGAAGGTCAAC
CAGGCTTTCGAAACCCTCAAGAGGTGTACCACGACCAACCCCAACCAGAGGCTGCCCAAG
GTGGAGATCCTCAGGAATGCCATCCGCTACATCGAGAGCCTGCAGGAGTTGCTGAGAGAG
CAGGTGGAGAACTACTATAGCCTGCCGGGACAGAGCTGCTCGGAGCCCACCAGCCCCACC
TCCAACTGCTCTGATGGCATGCCCGAATGTAACAGTCCTGTCTGGTCCAGAAAGAGCAGT
ACTTTTGACAGCATCTACTGTCCTGATGTATCAAATGTATATGCCACAGATAAAAACTCC
TTATCCAGCTTGGATTGCTTATCCAACATAGTGGACCGGATCACCTCCTCAGAGCAACCT
GGGTTGCCTCTCCAGGATCTGGCTTCTCTCTCTCCAGTTGCCAGCACCGATTCACAGCCT
GCAACTCCAGGGGCTTCTAGTTCCAGGCTTATCTATCATGTGCTATGA

Clone variation with respect to NM_005593.2
Restriction Sites Please inquire     
ACCN NM_005593
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005593.1, NP_005584.1
RefSeq Size 1427 bp
RefSeq ORF 768 bp
Locus ID 4617
UniProt ID P13349
Domains HLH, Basic
Protein Families Druggable Genome, Transcription Factors
Gene Summary Transcriptional activator that promotes transcription of muscle-specific target genes and plays a role in muscle differentiation (PubMed:29887215). Together with MYOG and MYOD1, co-occupies muscle-specific gene promoter core region during myogenesis. Induces fibroblasts to differentiate into myoblasts. Probable sequence specific DNA-binding protein.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...