NSL1 (NM_001042549) Human Untagged Clone
CAT＃: SC311349
NSL1 (untagged)-Human NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) (NSL1), transcript variant 2
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C1orf48; DC8; MIS14 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC311349 representing NM_001042549.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGGGTCTCCTGAGTTGGTGGTCCTTGACCCTCCATGGGACAAGGAGCTCGCGGCTGGCACAGAG AGCCAGGCCTTGGTCTCCGCCACTCCCCGAGAAGACTTTCGGGTGCGCTGCACCTCGAAGCGGGCTGTG ACCGAAATGCTACAACTGTGCGGCCGCTTCGTGCAAAAGCTCGGGGACGCTCTGCCGGAGGAGATTCGG GAGCCCGCTCTGCGAGATGCGCAGTGGACTTTTGAATCAGCTGTGCAAGAGAATATCAGCATTAATGGG CAAGCATGGCAGGAAGCTTCAGATAATTGTTTTATGGATTCTGACATCAAAGTACTTGAAGATCAGTTT GATGAAATCATAGTAGATATAGCCACAAAACGTAAGCAGTATCCCAGAAAGATCCTGGAATGTGTCATC AAAACCATAAAAGCAAAACAAGAAATTCTGAAGCAGTACCACCCTGTTGTACATCCACTGGACCTAAAA TATGACCCTGATCCAGTTCTCAACGGGAATGCTTTCAACTTTTCCCCATTCAACATGATGTTGGCTGTG GATTTGTCATATATGGTTTTTATTACTTCGAGCCCCTCATATGGAAAATTTGAAATGCAGAGGGGAAAC AGTAGCAAAGGAGATCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001042549 |
| Insert Size | 642 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001042549.1 |
| RefSeq Size | 13233 bp |
| RefSeq ORF | 642 bp |
| Locus ID | 25936 |
| UniProt ID | Q96IY1 |
| MW | 24.1 kDa |
| Gene Summary | This gene encodes a protein with two coiled-coil domains that localizes to kinetochores, which are chromosome-associated structures that attach to microtubules and mediate chromosome movements during cell division. The encoded protein is part of a conserved protein complex that includes two chromodomain-containing proteins and a component of the outer plate of the kinetochore. This protein complex is proposed to bridge centromeric heterochromatin with the outer kinetochore structure. Multiple transcript variants encoding different isoforms have been found for this gene. There is a pseudogene of the 3' UTR region of this gene on chromosome X. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (2) contains an alternate exon, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213718 | NSL1 (Myc-DDK-tagged)-Human NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) (NSL1), transcript variant 2 |
CNY 2400.00 |
|
| RC213718L3 | Lenti ORF clone of Human NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) (NSL1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC213718L4 | Lenti ORF clone of Human NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) (NSL1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
| RG213718 | NSL1 (tGFP-tagged) - Human NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) (NSL1), transcript variant 2 |
CNY 4370.00 |
