NSL1 (NM_001042549) Human Untagged Clone

CAT#: SC311349

NSL1 (untagged)-Human NSL1, MIND kinetochore complex component, homolog (S. cerevisiae) (NSL1), transcript variant 2



  "NM_001042549" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
NSL1 mouse monoclonal antibody,clone OTI6F7
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C1orf48; DC8; MIS14
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC311349 representing NM_001042549.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGGGTCTCCTGAGTTGGTGGTCCTTGACCCTCCATGGGACAAGGAGCTCGCGGCTGGCACAGAG
AGCCAGGCCTTGGTCTCCGCCACTCCCCGAGAAGACTTTCGGGTGCGCTGCACCTCGAAGCGGGCTGTG
ACCGAAATGCTACAACTGTGCGGCCGCTTCGTGCAAAAGCTCGGGGACGCTCTGCCGGAGGAGATTCGG
GAGCCCGCTCTGCGAGATGCGCAGTGGACTTTTGAATCAGCTGTGCAAGAGAATATCAGCATTAATGGG
CAAGCATGGCAGGAAGCTTCAGATAATTGTTTTATGGATTCTGACATCAAAGTACTTGAAGATCAGTTT
GATGAAATCATAGTAGATATAGCCACAAAACGTAAGCAGTATCCCAGAAAGATCCTGGAATGTGTCATC
AAAACCATAAAAGCAAAACAAGAAATTCTGAAGCAGTACCACCCTGTTGTACATCCACTGGACCTAAAA
TATGACCCTGATCCAGTTCTCAACGGGAATGCTTTCAACTTTTCCCCATTCAACATGATGTTGGCTGTG
GATTTGTCATATATGGTTTTTATTACTTCGAGCCCCTCATATGGAAAATTTGAAATGCAGAGGGGAAAC
AGTAGCAAAGGAGATCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001042549
Insert Size 642 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001042549.1
RefSeq Size 13233 bp
RefSeq ORF 642 bp
Locus ID 25936
UniProt ID Q96IY1
MW 24.1 kDa
Gene Summary This gene encodes a protein with two coiled-coil domains that localizes to kinetochores, which are chromosome-associated structures that attach to microtubules and mediate chromosome movements during cell division. The encoded protein is part of a conserved protein complex that includes two chromodomain-containing proteins and a component of the outer plate of the kinetochore. This protein complex is proposed to bridge centromeric heterochromatin with the outer kinetochore structure. Multiple transcript variants encoding different isoforms have been found for this gene. There is a pseudogene of the 3' UTR region of this gene on chromosome X. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (2) contains an alternate exon, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...