Pejvakin (DFNB59) (NM_001042702) Human Untagged Clone

CAT#: SC311471

DFNB59 (untagged)-Human deafness, autosomal recessive 59 (DFNB59)



  "NM_001042702" in other vectors (4)

CNY 3656.00

CNY 7220.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
PJVK Rabbit pAb
    • 100 ul

CNY 2640.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DFNB59
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001042702, the custom clone sequence may differ by one or more nucleotides


ATGTTTGCTGCTGCTACCAAGAGCTTTGTCAAGCAAGTTGGAGATGGAGGGAGATTAGTTCCTGTTCCAA
GCCTCAGTGAAGCTGACAAATATCAACCTCTAAGTCTGGTGGTAAAAAAGAAGCGATGCTTTCTGTTTCC
TAGATATAAATTTACTTCAACACCTTTTACACTGAAAGATATTCTCCTAGGAGACAGAGAAATTTCAGCT
GGTATTTCATCTTATCAATTACTGAATTATGAAGATGAATCAGATGTTTCACTCTATGGAAGGCGAGGTA
ACCATATTGTAAATGACGTTGGGATTAACGTTGCTGGATCAGATTCCATTGCAGTGAAAGCTTCATTTGG
TATAGTAACCAAACATGAAGTGGAAGTATCAACATTACTCAAAGAAATTACTACACGAAAAATTAACTTT
GACCACAGCTTGATACGTCAGTCAAGGAGCAGCAGAAAGGCAGTATTGTGTGTGGTCATGGAGAGCATCC
GAACCACACGACAGTGCTCACTGTCTGTGCATGCTGGAATTCGAGGGGAAGCAATGCGGTTTCACTTTAT
GGATGAACAGAATCCCAAGGGAAGGGACAAAGCTATTGTTTTCCCAGCACATACAACCATAGCTTTCAGT
GTTTTTGAACTCTTCATATACCTGGATGGTGCCTTTGACCTTTGTGTCACTTCAGTGTCAAAAGGAGGAT
TTGAAAGGGAAGAAACGGCAACATTTGCACTGCTGTACAGGTTGAGAAATATCCTATTTGAAAGAAATAG
AAGAGTGATGGATGTCATTTCTCGTTCACAGCTTTACTTGGATGATCTTTTTTCTGACTACTATGACAAA
CCTCTCAGCATGACTGATATTTCACTCAAAGAAGGGACCCATATCCGAGTTAACTTACTTAATCACAACA
TTCCCAAAGGGCCTTGCATACTCTGTGGAATGGGGAACTTCAAAAGGGAGACAGTTTATGGGTGCTTTCA
GTGTTCTGTTGATGGTCAGAAGTATGTGAGACTTCATGCAGTTCCTTGTTTTGATATTTGGCACAAGAGG
ATGAAATAA


Restriction Sites Please inquire     
ACCN NM_001042702
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001042702.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001042702.1, NP_001036167.1
RefSeq Size 1415 bp
RefSeq ORF 1059 bp
Locus ID 494513
UniProt ID Q0ZLH3
Gene Summary The protein encoded by this gene is a member of the gasdermin family, a family which is found only in vertebrates. The encoded protein is required for the proper function of auditory pathway neurons. Defects in this gene are a cause of non-syndromic sensorineural deafness autosomal recessive type 59 (DFNB59). [provided by RefSeq, Dec 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...