Pejvakin (DFNB59) (NM_001042702) Human Untagged Clone
CAT＃: SC311471
DFNB59 (untagged)-Human deafness, autosomal recessive 59 (DFNB59)
CNY 3656.00
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DFNB59 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001042702, the custom clone sequence may differ by one or more nucleotides
ATGTTTGCTGCTGCTACCAAGAGCTTTGTCAAGCAAGTTGGAGATGGAGGGAGATTAGTTCCTGTTCCAA GCCTCAGTGAAGCTGACAAATATCAACCTCTAAGTCTGGTGGTAAAAAAGAAGCGATGCTTTCTGTTTCC TAGATATAAATTTACTTCAACACCTTTTACACTGAAAGATATTCTCCTAGGAGACAGAGAAATTTCAGCT GGTATTTCATCTTATCAATTACTGAATTATGAAGATGAATCAGATGTTTCACTCTATGGAAGGCGAGGTA ACCATATTGTAAATGACGTTGGGATTAACGTTGCTGGATCAGATTCCATTGCAGTGAAAGCTTCATTTGG TATAGTAACCAAACATGAAGTGGAAGTATCAACATTACTCAAAGAAATTACTACACGAAAAATTAACTTT GACCACAGCTTGATACGTCAGTCAAGGAGCAGCAGAAAGGCAGTATTGTGTGTGGTCATGGAGAGCATCC GAACCACACGACAGTGCTCACTGTCTGTGCATGCTGGAATTCGAGGGGAAGCAATGCGGTTTCACTTTAT GGATGAACAGAATCCCAAGGGAAGGGACAAAGCTATTGTTTTCCCAGCACATACAACCATAGCTTTCAGT GTTTTTGAACTCTTCATATACCTGGATGGTGCCTTTGACCTTTGTGTCACTTCAGTGTCAAAAGGAGGAT TTGAAAGGGAAGAAACGGCAACATTTGCACTGCTGTACAGGTTGAGAAATATCCTATTTGAAAGAAATAG AAGAGTGATGGATGTCATTTCTCGTTCACAGCTTTACTTGGATGATCTTTTTTCTGACTACTATGACAAA CCTCTCAGCATGACTGATATTTCACTCAAAGAAGGGACCCATATCCGAGTTAACTTACTTAATCACAACA TTCCCAAAGGGCCTTGCATACTCTGTGGAATGGGGAACTTCAAAAGGGAGACAGTTTATGGGTGCTTTCA GTGTTCTGTTGATGGTCAGAAGTATGTGAGACTTCATGCAGTTCCTTGTTTTGATATTTGGCACAAGAGG ATGAAATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001042702 |
| Insert Size | 1200 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001042702.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001042702.1, NP_001036167.1 |
| RefSeq Size | 1415 bp |
| RefSeq ORF | 1059 bp |
| Locus ID | 494513 |
| UniProt ID | Q0ZLH3 |
| Gene Summary | The protein encoded by this gene is a member of the gasdermin family, a family which is found only in vertebrates. The encoded protein is required for the proper function of auditory pathway neurons. Defects in this gene are a cause of non-syndromic sensorineural deafness autosomal recessive type 59 (DFNB59). [provided by RefSeq, Dec 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212618 | DFNB59 (Myc-DDK-tagged)-Human deafness, autosomal recessive 59 (DFNB59) |
CNY 3656.00 |
|
| RC212618L3 | Lenti ORF clone of Human deafness, autosomal recessive 59 (DFNB59), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC212618L4 | Lenti ORF clone of Human deafness, autosomal recessive 59 (DFNB59), mGFP tagged |
CNY 5890.00 |
|
| RG212618 | DFNB59 (tGFP-tagged) - Human deafness, autosomal recessive 59 (DFNB59) |
CNY 4370.00 |
其它Pejvakin产品
