GALNT9 (NM_021808) Human Untagged Clone
CAT#: SC312588
GALNT9 (untagged)-Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9) (GALNT9), transcript variant B
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GALNAC-T9; GALNACT9 |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_021808 edited
AGGCCAACTTCAGCCTGGCACGGCGGCGCCGCGGACTCCACCATCCCGGGGAAGGAGCCG GACCCCTGTGTGGCAGTGTGGCGGCAGCATGGAGGTGCTGCCCTGCTCCCGCGTGGCCCA CATCGAGCGCACCAGGAAGCCCTACAACAACGACATTGACTACTACGCCAAGCGCAACGC CCTGCGCGCCGCCGAGGTGTGGATGGATGACTTCAAGTCCCACGTGTACATGGCCTGGAA CATCCCCATGTCGAACCCAGGGGTGGACTTCGGGGACGTGTCTGAGAGGCTGGCCCTGCG TCAGAGGCTGAAGTGTCGCAGCTTCAAGTGGTACCTGGAGAACGTGTACCCGGAGATGAG GGTCTACAACAACACCCTCACGTACGGAGAGGTGAGAAACAGCAAAGCCAGTGCCTACTG TCTGGACCAGGGAGCGGAGGACGGCGACCGGGCGATCCTCTACCCCTGCCACGGGATGTC CTCCCAGCTGGTGCGGTACAGCGCTGACGGCCTGCTGCAGCTGGGGCCTCTGGGCTCCAC AGCCTTCTTGCCTGACTCCAAGTGTCTGGTGGATGACGGCACGGGCCGCATGCCCACCCT GAAGAAGTGTGAGGATGTGGCGCGGCCAACACAGCGGCTGTGGGACTTCACCCAGAGTGG CCCCATTGTGAGCCGGGCCACGGGCCGCTGCCTGGAGGTGGAGATGTCCAAAGATGCCAA CTTTGGGCTCCGGCTGGTGGTACAGAGGTGCTCGGGGCAGAAGTGGATGATCAGAAACTG GATCAAACACGCACGGCACTGACCCCACCTCCGCCCGGACCCCCACAGACCTCGGG |
Restriction Sites | Please inquire |
ACCN | NM_021808 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_021808.2, NP_068580.2 |
RefSeq Size | 1741 bp |
RefSeq ORF | 714 bp |
Locus ID | 50614 |
UniProt ID | Q9HCQ5 |
Protein Families | Transmembrane |
Protein Pathways | Metabolic pathways, O-Glycan biosynthesis |
Gene Summary | This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. This gene is expressed specifically in the brain, with highest expression in the cerebellum. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (B) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant A. The resulting isoform (B) has a shorter N-terminus compared to isoform A, and lacks the glycosyltransferase domain. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218566 | GALNT9 (Myc-DDK-tagged)-Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9) (GALNT9), transcript variant B |
CNY 2400.00 |
|
RC218566L1 | Lenti ORF clone of Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9) (GALNT9), transcript variant B, Myc-DDK-tagged |
CNY 4800.00 |
|
RC218566L2 | Lenti ORF clone of Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9) (GALNT9), transcript variant B, mGFP tagged |
CNY 5890.00 |
|
RC218566L3 | Lenti ORF clone of Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9) (GALNT9), transcript variant B, Myc-DDK-tagged |
CNY 5890.00 |
|
RC218566L4 | Lenti ORF clone of Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9) (GALNT9), transcript variant B, mGFP tagged |
CNY 5890.00 |
|
RG218566 | GALNT9 (tGFP-tagged) - Human UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9) (GALNT9), transcript variant B |
CNY 4000.00 |