CPSF30 (CPSF4) (NM_006693) Human Untagged Clone
CAT#: SC312726
CPSF4 (untagged)-Human cleavage and polyadenylation specific factor 4, 30kDa (CPSF4), transcript variant 1
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CPSF30; NAR; NEB-1; NEB1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312726 representing NM_006693.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGGAAATCATCGCCAGCGTGGACCACATCAAGTTTGACTTGGAGATCGCGGTGGAGCAGCAGCTG GGGGCGCAGCCGCTGCCCTTCCCCGGCATGGACAAGTCGGGCGCTGCTGTCTGTGAATTCTTTTTGAAA GCTGCCTGCGGCAAAGGGGGCATGTGTCCGTTTCGCCACATCAGTGGTGAGAAGACAGTTGTGTGCAAA CACTGGCTGCGTGGCCTATGCAAGAAAGGGGACCAGTGTGAGTTCCTGCATGAGTATGACATGACCAAG ATGCCCGAGTGCTACTTCTACTCCAAGTTCGGGGAGTGCAGCAACAAGGAATGTCCCTTCCTGCACATC GACCCCGAGTCCAAGATCAAGGACTGTCCTTGGTATGACCGTGGCTTCTGCAAGCACGGTCCCCTCTGC AGGCACCGGCACACACGGAGAGTCATCTGTGTGAATTACCTCGTGGGATTCTGCCCGGAGGGGCCCTCG TGTAAATTCATGCACCCTCGATTTGAACTGCCCATGGGAACCACCGAGCAGCCCCCACTGCCGCAGCAG ACACAGCCTCCAGCAAAGCAAAGTAACAATCCGCCATTACAAAGGTCGTCCTCCTTGATCCAGTTAACG AGTCAGAACTCTTCTCCCAATCAGCAGAGAACCCCGCAGGTCATCGGGGTCATGCAGAGTCAAAACAGC AGCGCGGGCAACCGGGGACCCCGGCCACTGGAGCAGGTCACCTGTTACAAGTGTGGCGAGAAAGGACAC TACGCCAACAGATGCACCAAAGGGCACTTGGCCTTTCTCAGTGGACAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_006693 |
Insert Size | 810 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006693.3 |
RefSeq Size | 1850 bp |
RefSeq ORF | 810 bp |
Locus ID | 10898 |
UniProt ID | O95639 |
Domains | zf-CCCH, zf-CCHC |
MW | 30.3 kDa |
Gene Summary | Inhibition of the nuclear export of poly(A)-containing mRNAs caused by the influenza A virus NS1 protein requires its effector domain. The NS1 effector domain functionally interacts with the cellular 30 kDa subunit of cleavage and polyadenylation specific factor 4, an essential component of the 3' end processing machinery of cellular pre-mRNAs. In influenza virus-infected cells, the NS1 protein is physically associated with cleavage and polyadenylation specific factor 4, 30kD subunit. Binding of the NS1 protein to the 30 kDa protein in vitro prevents CPSF binding to the RNA substrate and inhibits 3' end cleavage and polyadenylation of host pre-mRNAs. Thus the NS1 protein selectively inhibits the nuclear export of cellular, and not viral, mRNAs. Multiple alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217281 | CPSF4 (Myc-DDK-tagged)-Human cleavage and polyadenylation specific factor 4, 30kDa (CPSF4), transcript variant 1 |
CNY 2400.00 |
|
RC217281L3 | Lenti ORF clone of Human cleavage and polyadenylation specific factor 4, 30kDa (CPSF4), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC217281L4 | Lenti ORF clone of Human cleavage and polyadenylation specific factor 4, 30kDa (CPSF4), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RG217281 | CPSF4 (tGFP-tagged) - Human cleavage and polyadenylation specific factor 4, 30kDa (CPSF4), transcript variant 1 |
CNY 4370.00 |