ST3GAL4 (NM_006278) Human Untagged Clone

CAT#: SC312986

ST3GAL4 (untagged)-Human ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4)



  "NM_006278" in other vectors (6)

CNY 6270.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-ST3GAL4 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CGS23; gal-NAc6S; NANTA3; SAT3; SIAT4; SIAT4C; ST-4; ST3GalA.2; ST3GalIV; STZ
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_006278, the custom clone sequence may differ by one or more nucleotides


ATGGTCAGCAAGTCCCGCTGGAAGCTCCTGGCCATGTTGGCTCTGGTCCTGGTCGTCATGGTGTGGTATT
CCATCTCCCGGGAAGACAGTTTTTATTTTCCCATCCCAGAGAAGAAGGAGCCGTGCCTCCAGGGTGAGGC
AGAGAGCAAGGCCTCTAAGCTCTTTGGCAACTACTCCCGGGATCAGCCCATCTTCCTGCGGCTTGAGGAT
TATTTCTGGGTCAAGACGCCATCTGCTTACGAGCTGCCCTATGGGACCAAGGGGAGTGAGGATCTGCTCC
TCCGGGTGCTAGCCATCACCAGCTCCTCCATCCCCAAGAACATCCAGAGCCTCAGGTGCCGCCGCTGTGT
GGTCGTGGGGAACGGGCACCGGCTGCGGAACAGCTCACTGGGAGATGCCATCAACAAGTACGATGTGGTC
ATCAGATTGAACAATGCCCCAGTGGCTGGCTATGAGGGTGACGTGGGCTCCAAGACCACCATGCGTCTCT
TCTACCCTGAATCTGCCCACTTCGACCCCAAAGTAGAAAACAACCCAGACACACTCCTCGTCCTGGTAGC
TTTCAAGGCAATGGACTTCCACTGGATTGAGACCATCCTGAGTGATAAGAAGCGGGTGCGAAAGGGTTTC
TGGAAACAGCCTCCCCTCATCTGGGATGTCAATCCTAAACAGATTCGGATTCTCAACCCCTTCTTCATGG
AGATTGCAGCTGACAAACTGCTGAGCCTGCCAATGCAACAGCCACGGAAGATTAAGCAGAAGCCCACCAC
GGGCCTGTTGGCCATCACGCTGGCCCTCCACCTCTGTGACTTGGTGCACATTGCCGGCTTTGGCTACCCA
GACGCCTACAACAAGAAGCAGACCATTCACTACTATGAGCAGATCACGCTCAAGTCCATGGCGGGGTCAG
GCCATAATGTCTCCCAAGAGGCCCTGGCCATTAAGCGGATGCTGGAGATGGGAGCTATCAAGAACCTCAC
GTCCTTCTGA


Restriction Sites Please inquire     
ACCN NM_006278
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_006278.1, NP_006269.1
RefSeq Size 1766 bp
RefSeq ORF 990 bp
Locus ID 6484
UniProt ID Q11206
Domains Glyco_transf_29
Protein Families Secreted Protein, Transmembrane
Protein Pathways Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways
Gene Summary This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (1), as well as variant 9, encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...