CD130 (IL6ST) (NM_175767) Human Untagged Clone
CAT#: SC312989
IL6ST (untagged)-Human interleukin 6 signal transducer (gp130, oncostatin M receptor) (IL6ST), transcript variant 2
CNY 2400.00
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD130; CDW130; GP130; HIES4; IL-6RB; sGP130 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_175767 edited
ATGTTGACGTTGCAGACTTGGCTAGTGCAAGCCTTGTTTATTTTCCTCACCACTGAATCT ACAGGTGAACTTCTAGATCCATGTGGTTATATCAGTCCTGAATCTCCAGTTGTACAACTT CATTCTAATTTCACTGCAGTTTGTGTGCTAAAGGAAAAATGTATGGATTATTTTCATGTA AATGCTAATTACATTGTCTGGAAAACAAACCATTTTACTATTCCTAAGGAGCAATATACT ATCATAAACAGAACAGCATCCAGTGTCACCTTTACAGATATAGCTTCATTAAATATTCAG CTCACTTGCAACATTCTTACATTCGGACAGCTTGAACAGAATGTTTATGGAATCACAATA ATTTCAGGCTTGCCTCCAGAAAAACCTAAAAATTTGAGTTGCATTGTGAACGAGGGGAAG AAAATGAGGTGTGAGTGGGATGGTGGAAGGGAAACACACTTGGAGACAAACTTCACTTTA AAATCTGAATGGGCAACACACAAGTTTGCTGATTGCAAAGCAAAACGTGACACCCCCACC TCATGCACTGTTGATTATTCTACTGTGTATTTTGTCAACATTGAAGTCTGGGTAGAAGCA GAGAATGCCCTTGGGAAGGTTACATCAGATCATATCAATTTTGATCCTGTATATAAAGTG AAGCCCAATCCGCCACATAATTTATCAGTGATCAACTCAGAGGAACTGTCTAGTATCTTA AAATTGACATGGACCAACCCAAGTATTAAGAGTGTTATAATACTAAAATATAACATTCAA TATAGGACCAAAGATGCCTCAACTTGGAGCCAGATTCCTCCTGAAGACACAGCATCCACC CGATCTTCATTCACTGTCCAAGACCTTAAACCTTTTACAGAATATGTGTTTAGGATTCGC TGTATGAAGGAAGATGGTAAGGGATACTGGAGTGACTGGAGTGAAGAAGCAAGTGGGATC ACCTATGAAGATAACATTGCCTCCTTTTGA |
Restriction Sites | Please inquire |
ACCN | NM_175767 |
Insert Size | 2400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_175767.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_175767.1, NP_786943.1 |
RefSeq Size | 3159 bp |
RefSeq ORF | 990 bp |
Locus ID | 3572 |
UniProt ID | P40189 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Cytokine-cytokine receptor interaction, Jak-STAT signaling pathway |
Gene Summary | The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggest that this gene plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants have been described. A related pseudogene has been identified on chromosome 17. [provided by RefSeq, May 2014] Transcript Variant: This variant (2) lacks an alternate internal exon, which results in a frameshift in the 3' coding region and a premature termination codon, compared to variant 1. The resulting isoform (2, also known as gp130-RAPS) has a distinct and shorter C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS ID represents the gp130-RAPS isoform described in PMIDs: 10880057 and 16646038. This variant is supported by the transcript AB015706.1. It should be noted that this transcript is predicted to undergo nonsense-mediated mRNA decay (NMD). However, the protein is represented because it was detected endogenously in PMID:10880057 using an antibody specific for the distinct C-terminus of this isoform. It is likely that the majority of transcripts representing this variant will undergo NMD, while some low level of NMD escape may allow for the expression of this isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223001 | IL6ST (Myc-DDK-tagged)-Human interleukin 6 signal transducer (gp130, oncostatin M receptor) (IL6ST), transcript variant 2 |
CNY 2400.00 |
|
RC223001L3 | Lenti ORF clone of Human interleukin 6 signal transducer (gp130, oncostatin M receptor) (IL6ST), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC223001L4 | Lenti ORF clone of Human interleukin 6 signal transducer (gp130, oncostatin M receptor) (IL6ST), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG223001 | IL6ST (tGFP-tagged) - Human interleukin 6 signal transducer (gp130, oncostatin M receptor) (IL6ST), transcript variant 2 |
CNY 4370.00 |