galectin 9 (LGALS9) (NM_009587) Human Untagged Clone

CAT#: SC313107

LGALS9 (untagged)-Human lectin, galactoside-binding, soluble, 9 (LGALS9), transcript variant 1



  "NM_009587" in other vectors (6)

CNY 3656.00

CNY 5700.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
LGALS9 mouse monoclonal antibody, clone OTI1D12 (formerly 1D12)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HUAT; LGALS9A
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_009587 edited
ATGGCCTTCAGCGGTTCCCAGGCTCCCTACCTGAGTCCAGCTGTCCCCTTTTCTGGGACT
ATTCAAGGAGGTCTCCAGGACGGACTTCAGATCACTGTCAATGGGACCGTTCTCAGCTCC
AGTGGAACCAGGTTTGCTGTGAACTTTCAGACTGGCTTCAGTGGAAATGACATTGCCTTC
CACTTCAACCCTCGGTTTGAAGATGGAGGGTACGTGGTGTGCAACACGAGGCAGAACGGA
AGCTGGGGGCCCGAGGAGAGGAAGACACACATGCCTTTCCAGAAGGGGATGCCCTTTGAC
CTCTGCTTCCTGGTGCAGAGCTCAGATTTCAAGGTGATGGTGAACGGGATCCTCTTCGTG
CAGTACTTCCACCGCGTGCCCTTCCACCGTGTGGACACCATCTCCGTCAATGGCTCTGTG
CAGCTGTCCTACATCAGCTTCCAGAACCCCCGCACAGTCCCTGTTCAGCCTGCCTTCTCC
ACGGTGCCGTTCTCCCAGCCTGTCTGTTTCCCACCCAGGCCCAGGGGGCGCAGACAAAAA
CCTCCCGGCGTGTGGCCTGCCAACCCGGCTCCCATTACCCAGACAGTCATCCACACAGTG
CAGAGCGCCCCTGGACAGATGTTCTCTACTCCCGCCATCCCACCTATGATGTACCCCCAC
CCCGCCTATCCGATGCCTTTCATCACCACCATTCTGGGAGGGCTGTACCCATCCAAGTCC
ATCCTCCTGTCAGGCACTGTCCTGCCCAGTGCTCAGAGGTTCCACATCAACCTGTGCTCT
GGGAACCACATCGCCTTCCACCTGAACCCCCGTTTTGATGAGAATGCTGTGGTCCGCAAC
ACCCAGATCGACAACTCCTGGGGGTCTGAGGAGCGAAGTCTGCCCCGAAAAATGCCCTTC
GTCCGTGGCCAGAGCTTCTCAGTGTGGATCTTGTGTGAAGCTCACTGCCTCAAGGTGGCC
GTGGATGGTCAGCACCTGTTTGAATACTACCATCGCCTGAGGAACCTGCCCACCATCAAC
AGACTGGAAGTGGGGGGCGACATCCAGCTGACCCATGTGCAGACATAG
Restriction Sites Please inquire     
ACCN NM_009587
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_009587.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_009587.1, NP_033665.1
RefSeq Size 1696 bp
RefSeq ORF 1068 bp
Locus ID 3965
UniProt ID O00182
Domains Gal-bind_lectin
Gene Summary The galectins are a family of beta-galactoside-binding proteins implicated in modulating cell-cell and cell-matrix interactions. The protein encoded by this gene is an S-type lectin. It is overexpressed in Hodgkin's disease tissue and might participate in the interaction between the H&RS cells with their surrounding cells and might thus play a role in the pathogenesis of this disease and/or its associated immunodeficiency. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) encodes the longer isoform (long).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...