STK19 (NM_004197) Human Untagged Clone

CAT#: SC313140

STK19 (untagged)-Human serine/threonine kinase 19 (STK19), transcript variant 1



  "NM_004197" in other vectors (6)

CNY 5990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
STK19 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms D6S60; D6S60E; G11; HLA-RP1; RP1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313140 representing NM_004197.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAAAAGTGGTTTTCTGCTTTCGATGATGCAATCATTCAGCGACAGTGGCGGGCAAACCCCTCCCGG
GGCGGGGGAGGTGTGAGCTTCACGAAGGAGGTTGACACCAACGTGGCCACCGGCGCCCCTCCACGCCGC
CAACGAGTCCCCGGGCGTGCGTGCCCTTGGAGGGAGCCAATCCGCGGCCGGCGTGGGGCCCGGCCTGGC
GGAGGTGATGCTGGAGGGACGCCCGGGGAGACCGTACGTCACTGCTCTGCGCCGGAAGACCCTATTTTC
AGGTTCTCTTCCCTCCATTCCTACCCCTTCCCCGGTACCATAAAATCCCGGGATATGAGCTGGAAGAGG
CATCACCTGATCCCGGAGACCTTTGGAGTTAAGAGGCGGCGGAAGCGAGGGCCTGTGGAGTCGGATCCT
CTTCGGGGTGAGCCAGGGTCGGCGCGCGCGGCTGTCTCAGAACTCATGCAGCTGTTCCCGCGAGGCCTG
TTTGAGGACGCGCTGCCGCCCATCGTGCTGAGGAGCCAGGTGTACAGCCTTGTGCCTGACAGGACCGTG
GCCGACCGGCAGCTGAAGGAGCTTCAAGAGCAGGGGGAGATCAGAATCGTCCAGCTGGGCTTCGACTTG
GATGCCCATGGAATTATCTTCACTGAGGACTACAGGACCAGAGTCCTCAAGGCCTGTGATGGCCGACCG
TATGCTGGGGCAGTGCAGAAATTTCTAGCTTCAGTACTTCCAGCCTGTGGGGACCTTAGTTTCCAGCAG
GACCAAATGACACAGACCTTTGGCTTCAGGGACTCAGAAATCACGCATCTGGTGAATGCTGGAGTCCTC
ACCGTCCGAGATGCTGGGAGCTGGTGGCTAGCTGTGCCTGGAGCTGGGAGATTCATCAAGTACTTTGTT
AAAGGGCGCCAGGCTGTCCTTAGCATGGTCCGGAAGGCAAAGTACCGGGAACTGCTCCTATCAGAGCTC
CTGGGCCGGCGGGCGCCTGTCGTGGTGCGGCTTGGCCTCACCTACCATGTGCACGACCTCATTGGGGCC
CAGCTAGTGGACTGCATCTCTACCACTTCAGGAACCCTCCTCCGCCTGCCAGAGACATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_004197
Insert Size 1095 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_004197.1
RefSeq Size 1620 bp
RefSeq ORF 1095 bp
Locus ID 8859
UniProt ID P49842
Protein Families Druggable Genome, Protein Kinase
MW 40.5 kDa
Gene Summary This gene encodes a serine/threonine kinase which localizes predominantly to the nucleus. Its specific function is unknown; it is possible that phosphorylation of this protein is involved in transcriptional regulation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6 and expresses two transcript variants. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) uses an alternate splice site in the coding region, compared to variant 2. It encodes isoform 1 which is shorter compared to isoform 2. Although isoforms 1 and 2 differ in the kinase domain, it appears that there is no difference in kinase activity between isoforms 1 and 2.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...