DDI2 (NM_032341) Human Untagged Clone
CAT#: SC313304
DDI2 (untagged)-Human DNA-damage inducible 1 homolog 2 (S. cerevisiae) (DDI2)
CNY 3656.00
CNY 6460.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_032341 edited
ATGCTGCTCACCGTGTACTGTGTGCGGAGGGACCTCTCCGAGGTGACCTTTTCCCTCCAG GTCGACGCCGACTTCGAGCTGCACAACTTCCGCGCGCTGTGCGAGCTCGAGTCTGGCATC CCCGCAGCCGAGAGCCAGATCGTCTATGCGGAAAGACCTCTCACAGACAACCACAGATCA TTGGCTTCTTATGGCTTGAAAGATGGGGACGTTGTGATTTTACGACAGAAGGAGAATGCA GACCCTCGACCTCCAGTGCAGTTCCCAAACTTACCCCGAATAGATTTCAGTAGTATAGCT GTGCCTGGCACATCAAGTCCCCGGCAGCGCCAGCCACCAGGAACACAGCAGTCCCACTCA TCTCCTGGAGAAATAACTTCATCTCCTCAGGGCTTGGACAATCCAGCCTTGCTCCGAGAT ATGTTGCTGGCCAACCCGCATGAGCTGTCCTTGCTGAAGGAACGCAATCCACCCCTGGCA GAAGCTCTGCTCAGTGGAGACCTTGAGAAATTTTCTAGAGTCCTGGTGGAGCAGCAGCAG GACCGAGCCCGGAGAGAGCAAGAAAGGATTCGTCTGTTTTCTGCTGATCCCTTTGACCTT GAAGCTCAGGCAAAGATAGAAGAAGATATAAGGCAACAGAACATTGAGGAAAACATGACA ATAGCTATGGAAGAGGCTCCGGAAAGTTTTGGCCAAGTAGTGATGCTTTATATTAACTGC AAAGTGAATGGACATCCTGTGAAAGCCTTTGTTGACTCAGGTGCCCAGATGACTATCATG AGCCAAGCTTGTGCAGAAAGGTGTAACATAATGAGACTGGTGGACCGTCGGTGGGCAGGG ATTGCCAAAGGAGTGGGCACCCAGAAGATTATTGGAAGGGTACATCTAGCTCAGGTTCAG ATTGAAGGAGATTTTTTGCCATGTTCCTTCTCTATACTTGAGGAACAGCCCATGGACATG CTTCTGGGACTGGACATGCTTAAACGGCACCAGTGTTCCATCGACCTGAAGAAAAATGTA CTCGTGATCGGCACCACAGGCTCCCAGACCACCTTTCTTCCTGAGGGAGAGCTACCAGAG TGTGCCCGGTTGGCATATGGGGCTGGAAGAGAGGATGTACGGCTAGAGGAGATTGCAGAC CAAGAATTAGCAGAAGCCCTTCAAAAATCAGCAGAGGATGCAGAGCGTCAGAAGCCATGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_032341 |
| Insert Size | 6000 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_032341.3. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_032341.3, NP_115717.3 |
| RefSeq Size | 1759 bp |
| RefSeq ORF | 1200 bp |
| Locus ID | 84301 |
| UniProt ID | Q5TDH0 |
| Protein Families | Druggable Genome |
| Gene Summary | Aspartic protease that mediates the cleavage of NFE2L1/NRF1 at 'Leu-104', thereby promoting release of NFE2L1/NRF1 from the endoplasmic reticulum membrane (PubMed:27676298, PubMed:27528193). Ubiquitination of NFE2L1/NRF1 is a prerequisite for cleavage, suggesting that DDI2 specifically recognizes and binds ubiquitinated NFE2L1/NRF1 (PubMed:27528193). Seems to act as a proteasomal shuttle which links the proteasome and replication fork proteins like RTF2 (Probable). Required, with DDI1, for cellular survival following replication stress. Together or redudantly with DDI1, removes RTF2 from stalled forks to allow cell cycle progression after replication stress and maintains genome integrity (PubMed:29290612).[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Removal of RTF2 from Stalled Replisomes Promotes Maintenance of Genome Integrity
,Kottemann, MC;Conti, BA;Lach, FP;Smogorzewska, A;,
Mol. Cell
,PubMed ID 29290612
[DDI2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218468 | DDI2 (Myc-DDK-tagged)-Human DNA-damage inducible 1 homolog 2 (S. cerevisiae) (DDI2) |
CNY 3656.00 |
|
| RC218468L3 | Lenti ORF clone of Human DNA-damage inducible 1 homolog 2 (S. cerevisiae) (DDI2), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC218468L4 | Lenti ORF clone of Human DNA-damage inducible 1 homolog 2 (S. cerevisiae) (DDI2), mGFP tagged |
CNY 5890.00 |
|
| RG218468 | DDI2 (tGFP-tagged) - Human DNA-damage inducible 1 homolog 2 (S. cerevisiae) (DDI2) |
CNY 4370.00 |
