SHARPIN (NM_030974) Human Untagged Clone

CAT#: SC313342

SHARPIN (untagged)-Human SHANK-associated RH domain interactor (SHARPIN), transcript variant 1



  "NM_030974" in other vectors (6)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SHARPIN mouse monoclonal antibody,clone OTI1F4
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SIPL1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313342 representing NM_030974.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGCCGCCAGCGGGCGGGGCGGCGGCGGCGGCCTCGGACTTGGGCTCCGCCGCAGTGCTCTTGGCT
GTGCACGCCGCGGTGAGGCCGCTGGGCGCCGGGCCAGACGCCGAGGCACAGCTGCGGAGGCTGCAGCTG
AGCGCGGACCCTGAGCGGCCTGGGCGCTTCCGGCTGGAGCTGCTGGGCGCGGGACCTGGGGCGGTTAAT
TTGGAGTGGCCCCTGGAGTCAGTTTCCTACACCATCCGAGGCCCCACCCAGCACGAGCTACAGCCTCCA
CCAGGAGGGCCTGGAACCCTCAGCCTGCACTTCCTCAACCCTCAGGAAGCTCAGCGGTGGGCAGTCCTA
GTCCGAGGTGCCACCGTGGAAGGACAGAATGGCAGCAAGAGCAACTCACCACCAGCCTTGGGCCCAGAA
GCATGCCCTGTCTCCCTGCCCAGTCCCCCGGAAGCCTCCACACTCAAGGGCCCTCCACCTGAGGCAGAT
CTTCCTAGGAGCCCTGGAAACTTGACGGAGAGAGAAGAGCTGGCAGGGAGCCTGGCCCGGGCTATTGCA
GGTGGAGACGAGAAGGGGGCAGCCCAAGTGGCAGCCGTCCTGGCCCAGCATCGTGTGGCCCTGAGTGTT
CAGCTTCAGGAGGCCTGCTTCCCACCTGGCCCCATCAGGCTGCAGGTCACACTTGAAGACGCTGCCTCT
GCCGCATCCGCCGCGTCCTCTGCACACGTTGCCCTGCAGGTCCACCCCCACTGCACTGTTGCAGCTCTC
CAGGAGCAGGTGTTCTCAGAGCTCGGTTTCCCGCCAGCCGTGCAACGCTGGGTCATCGGACGGTGCCTG
TGTGTGCCTGAGCGCAGCCTTGCCTCTTACGGGGTTCGGCAGGATGGGGACCCTGCTTTCCTCTACTTG
CTGTCAGCTCCTCGAGAAGCCCCAGCCACAGGACCTAGCCCTCAGCACCCCCAGAAGATGGACGGGGAA
CTTGGACGCTTGTTTCCCCCATCATTGGGGCTACCCCCAGGCCCCCAGCCAGCTGCCTCCAGCCTGCCC
AGTCCACTCCAGCCCAGCTGGTCCTGTCCTTCCTGCACCTTCATCAATGCCCCAGACCGCCCTGGCTGT
GAGATGTGTAGCACCCAGAGGCCCTGCACTTGGGACCCCCTTGCTGCAGCTTCCACCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_030974
Insert Size 1164 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_030974.3
RefSeq Size 1816 bp
RefSeq ORF 1164 bp
Locus ID 81858
UniProt ID Q9H0F6
Domains zf-RanBP
Protein Families Druggable Genome
MW 39.9 kDa
Gene Summary Component of the LUBAC complex which conjugates linear polyubiquitin chains in a head-to-tail manner to substrates and plays a key role in NF-kappa-B activation and regulation of inflammation. LUBAC conjugates linear polyubiquitin to IKBKG and RIPK1 and is involved in activation of the canonical NF-kappa-B and the JNK signaling pathways. Linear ubiquitination mediated by the LUBAC complex interferes with TNF-induced cell death and thereby prevents inflammation. LUBAC is recruited to the TNF-R1 signaling complex (TNF-RSC) following polyubiquitination of TNF-RSC components by BIRC2 and/or BIRC3 and to conjugate linear polyubiquitin to IKBKG and possibly other components contributing to the stability of the complex. Together with OTULIN, the LUBAC complex regulates the canonical Wnt signaling during angiogenesis.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) includes all coding exons, is not a candidate for nonsense-mediated decay, and encodes the protein product.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...