SPRED2 (NM_181784) Human Untagged Clone
CAT#: SC313375
SPRED2 (untagged)-Human sprouty-related, EVH1 domain containing 2 (SPRED2), transcript variant 1
CNY 5488.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Spred-2 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_181784 edited
ATGACCGAAGAAACACACCCAGACGATGACAGCTATATTGTGCGTGTCAAGGCTGTGGTT ATGACCAGAGATGACTCCAGCGGGGGATGGTTCCCACAGGAAGGAGGCGGGATCAGTCGC GTCGGGGTCTGTAAGGTCATGCACCCCGAAGGCAATGGACGAAGCGGCTTTCTCATCCAT GGTGAACGACAGAAAGACAAACTGGTGGTATTGGAATGCTATGTAAGAAAGGACTTGGTC TACACCAAAGCCAATCCAACGTTTCATCACTGGAAGGTCGATAATAGGAAGTTTGGACTT ACTTTCCAAAGCCCTGCTGATGCCCGAGCCTTTGACAGGGGAGTAAGGAAAGCAATCGAA GACCTTATAGAAGGTTCAACAACGTCATCTTCCACCATCCATAATGAAGCTGAGCTTGGC GATGATGACGTTTTTACAACAGCTACAGACAGTTCTTCTAATTCCTCTCAGAAGAGAGAG CAACCTACTCGGACAATCTCCTCTCCCACATCCTGTGAGCACCGGAGGATTTATACCCTG GGCCACCTCCACGACTCATACCCCACAGACCACTATCACCTCGATCAGCCGATGCCAAGG CCCTACCGCCAGGTGAGCTTCCCGGACGACGACGAGGAGATCGTGCGCATCAACCCCCGG GAGAAGATCTGGATGACGGGGTACGAGGATTACCGGCACGCACCCGTCAGGGGCAAGTAC CCGGACCCCTCGGAGGACGCGGACTCCTCCTACGTGCGCTTCGCCAAGGGCGAGGTCCCC AAGCATGACTACAACTACCCCTACGTGGACTCCTCAGACTTTGGCCTAGGCGAGGACCCC AAAGGCCGCGGGGGCAGCGTGATCAAGACGCAGCCCTCCCGGGGCAAGTCGCGGCGGCGG AAGGAGGACGGAGAGCGCTCGCGGTGCGTGTACTGCAGGGACATGTTCAACCACGAGGAG AACCGCCGGGGCCACTGCCAGGACGCGCCCGACTCCGTGAGAACTTGCATCCGCCGGGTG AGCTGCATGTGGTGCGCGGACAGCATGCTCTATCACTGTATGTCGGACCCCGAGGGAGAC TATACAGACCCTTGCTCGTGCGATACTAGCGACGAGAAGTTTTGCCTCCGGTGGATGGCT CTTATTGCCTTGTCTTTCCTGGCCCCCTGTATGTGCTGTTACCTGCCCCTTCGGGCCTGC TACCACTGCGGAGTGATGTGCAGGTGCTGTGGCGGGAAGCACAAAGCGGCCGCGTGA |
| Restriction Sites | NotI-NotI |
| ACCN | NM_181784 |
| Insert Size | 5000 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_181784.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_181784.1, NP_861449.1 |
| RefSeq Size | 4119 bp |
| RefSeq ORF | 1257 bp |
| Locus ID | 200734 |
| UniProt ID | Q7Z698 |
| Protein Pathways | Jak-STAT signaling pathway |
| Gene Summary | SPRED2 is a member of the Sprouty (see SPRY1; MIM 602465)/SPRED family of proteins that regulate growth factor-induced activation of the MAP kinase cascade (see MAPK1; MIM 176948) (Nonami et al., 2004 [PubMed 15465815]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (1) encodes the longer isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212199 | SPRED2 (Myc-DDK-tagged)-Human sprouty-related, EVH1 domain containing 2 (SPRED2), transcript variant 1 |
CNY 5488.00 |
|
| RC212199L3 | Lenti ORF clone of Human sprouty-related, EVH1 domain containing 2 (SPRED2), transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
| RC212199L4 | Lenti ORF clone of Human sprouty-related, EVH1 domain containing 2 (SPRED2), transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
| RG212199 | SPRED2 (tGFP-tagged) - Human sprouty-related, EVH1 domain containing 2 (SPRED2), transcript variant 1 |
CNY 7088.00 |
