KRT13 (NM_002274) Human Untagged Clone
CAT#: SC313385
KRT13 (untagged)-Human keratin 13 (KRT13), transcript variant 2
CNY 6750.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CK13; K13; WSN2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_002274, the custom clone sequence may differ by one or more nucleotides
ATGAGCCTCCGCCTGCAGAGCTCCTCTGCCAGCTATGGAGGTGGTTTCGGGGGTGGCTCT TGCCAGCTGGGAGGAGGCCGTGGTGTCTCTACCTGTTCAACTCGGTTTGTGTCTGGGGGA TCAGCTGGGGGCTATGGAGGCGGCGTGAGCTGTGGTTTTGGTGGAGGGGCTGGTAGTGGC TTTGGAGGTGGCTATGGAGGTGGCCTTGGAGGTGGCTATGGAGGTGGCCTTGGAGGTGGC TTTGGTGGGGGTTTTGCTGGTGGCTTTGTTGACTTTGGTGCTTGTGATGGCGGCCTCCTC ACTGGCAATGAGAAGATCACCATGCAGAACCTCAACGACCGCCTGGCTTCCTACCTGGAG AAGGTGCGCGCCCTGGAGGAGGCCAACGCTGACCTGGAGGTGAAGATCCGTGACTGGCAC CTGAAGCAGAGCCCAGCTAGCCCTGAGCGGGACTACAGCCCCTACTACAAGACCATTGAA GAGCTCCGGGACAAGATCCTGACCGCCACCATTGAAAACAACCGGGTCATCCTGGAGATT GACAATGCCAGGCTGGCTGTGGACGACTTCAGGCTCAAGTATGAGAATGAGCTGGCCCTG CGCCAGAGCGTGGAGGCCGACATCAACGGCCTGCGCCGGGTGCTGGATGAGCTCACTCTG TCTAAGACTGACCTGGAGATGCAGATCGAGAGCCTGAATGAAGAGCTAGCCTACATGAAG AAGAACCATGAAGAGGAGATGAAGGAATTTAGCAACCAGGTGGTCGGCCAGGTCAACGTG GAGATGGATGCCACCCCAGGCATTGACCTGACCCGCGTGCTGGCAGAGATGAGGGAGCAG TACGAGGCCATGGCAGAGAGGAACCGCCGGGATGCTGAGGAATGGTTCCACGCCAAGAGT GCAGAGCTGAACAAGGAGGTGTCTACCAACACTGCCATGATTCAGACCAGCAAGACAGAG ATCACGGAGCTCAGGCGCACGCTCCAAGGCCTGGAGATTGAGCTGCAGTCCCAGCTGAGC ATGAAAGCGGGGCTGGAGAACACGGTGGCAGAGACGGAGTGCCGCTATGCCCTGCAGCTG CAGCAGATCCAGGGACTCATCAGCAGCATCGAGGCCCAGCTGAGCGAGCTCCGCAGTGAG ATGGAGTGCCAGAACCAAGAGTACAAGATGCTGCTGGACATCAAGACACGTCTGGAGCAG GAGATCGCCACCTACCGCAGCCTGCTCGAGGGCCAGGACGCCAAGAAGCGTCAGCCCCCG |
Restriction Sites | Please inquire |
ACCN | NM_002274 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_002274.2, NP_002265.1 |
RefSeq Size | 1693 bp |
RefSeq ORF | 1263 bp |
Locus ID | 3860 |
UniProt ID | P13646 |
Domains | filament |
Gene Summary | The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. Most of the type I cytokeratins consist of acidic proteins which are arranged in pairs of heterotypic keratin chains. This type I cytokeratin is paired with keratin 4 and expressed in the suprabasal layers of non-cornified stratified epithelia. Mutations in this gene and keratin 4 have been associated with the autosomal dominant disorder White Sponge Nevus. The type I cytokeratins are clustered in a region of chromosome 17q21.2. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) utilizes an alternate splice site in the 3' coding region, which results in a frameshift and early stop codon, compared to transcript variant 1. The encoded isoform (b) is shorter, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218492 | KRT13 (Myc-DDK-tagged)-Human keratin 13 (KRT13), transcript variant 2 |
CNY 3656.00 |
|
RC218492L3 | Lenti-ORF clone of KRT13 (Myc-DDK-tagged)-Human keratin 13 (KRT13), transcript variant 2 |
CNY 5890.00 |
|
RC218492L4 | Lenti-ORF clone of KRT13 (mGFP-tagged)-Human keratin 13 (KRT13), transcript variant 2 |
CNY 5890.00 |
|
RG218492 | KRT13 (tGFP-tagged) - Human keratin 13 (KRT13), transcript variant 2 |
CNY 4370.00 |