TMEM150C (NM_001080506) Human Untagged Clone
CAT#: SC315703
TMEM150C (untagged)-Human transmembrane protein 150C (TMEM150C)
CNY 2400.00
CNY 3990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | TTN3 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001080506 edited
ATGGATGGGAAGAAATGCAGCGTATGGATGTTCCTACCTCTTGTATTTACTTTGTTTACT TCAGCTGGATTGTGGATAGTATACTTCATAGCTGTGGAAGATGACAAAATTTTACCATTA AATTCAGCTGAAAGGAAACCTGGTGTGAAGCATGCACCATATATAAGCATTGCAGGTGAT GATCCTCCTGCAAGCTGTGTGTTTAGTCAAGTTATGAACATGGCAGCCTTCCTAGCCCTT GTGGTAGCTGTTCTGCGCTTCATACAACTGAAACCGAAGGTTTTAAACCCGTGGCTGAAT ATTAGTGGATTGGTGGCTCTGTGTCTGGCTTCCTTCGGAATGACCTTACTTGGTAATTTT CAGCTCACAAATGATGAAGAAATCCATAACGTCGGAACTTCCTTGACCTTTGGATTTGGC ACATTGACCTGCTGGATCCAGGCTGCGCTGACACTCAAGGTCAACATCAAGAATGAAGGA CGGAGAGTTGGAATTCCACGGGTTATTCTGTCGGCATCTATCACTCTCTGTGTGGTCCTC TACTTCATCCTCATGGCCCAAAGCATCCACATGTATGCAGCCAGGGTCCAGTGGGGCCTG GTCATGTGCTTCCTGTCTTATTTTGGCACCTTTGCCGTGGAGTTCCGGCATTACCGCTAT GAGATTGTTTGCTCTGAGTACCAGGAGAATTTCCTAAGCTTCTCAGAAAGCCTGTCAGAA GCTTCTGAATATCAGACTGACCAGGTGTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001080506 |
| Insert Size | 1400 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001080506.1, NP_001073975.1 |
| RefSeq Size | 1888 bp |
| RefSeq ORF | 750 bp |
| Locus ID | 441027 |
| UniProt ID | B9EJG8 |
| Gene Summary | This gene encodes a transmembrane protein component of a mechanosensitve ion channel that is activated by mechanical stimuli in various cell types and confers slowly adapting, mechanically activated currents in dorsal root ganglion neurons. Mechanically activated ion channels are sensors that are critical for hearing, touch, pain, and blood pressure regulation. [provided by RefSeq, Jul 2017] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219737 | TMEM150C (Myc-DDK-tagged)-Human transmembrane protein 150C (TMEM150C) |
CNY 2400.00 |
|
| RC219737L3 | Lenti ORF clone of Human transmembrane protein 150C (TMEM150C), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC219737L4 | Lenti ORF clone of Human transmembrane protein 150C (TMEM150C), mGFP tagged |
CNY 5890.00 |
|
| RG219737 | TMEM150C (tGFP-tagged) - Human transmembrane protein 150C (TMEM150C) |
CNY 4370.00 |
其它TMEM150C产品
