UNC119B (NM_001080533) Human Untagged Clone
CAT#: SC315704
UNC119B (untagged)-Human unc-119 homolog B (C. elegans) (UNC119B)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | POC7B |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001080533 edited
ATGAGCGGGTCTAACCCGAAGGCTGCGGCCGCGGCGTCGGCGGCTGGGCCCGGGGGGCTG GTGGCTGGCAAGGAGGAGAAGAAGAAGGCGGGCGGCGGCGTCCTGAACCGCCTGAAGGCG CGGCGGCAGGCGCCCCACCACGCGGCCGACGACGGCGTCGGGGCAGCGGTCACGGAGCAG GAGCTGCTGGCGCTGGACACCATCCGGCCCGAGCACGTCCTGCGCCTCAGCCGGGTCACC GAGAATTATTTATGTAAACCCGAAGACAACATCTACAGTATTGATTTCACCCGCTTCAAA ATTCGAGATTTGGAGACAGGGACAGTACTTTTTGAGATTGCCAAACCTTGCGTTTCAGAC CAGGAGGAGGATGAGGAGGAGGGAGGTGGAGACGTGGACATCAGCGCAGGACGTTTTGTC CGCTATCAGTTCACACCGGCATTTCTCCGCCTCCGGACAGTCGGGGCTACGGTGGAGTTC ACAGTGGGAGACAAACCTGTTTCAAACTTCCGGATGATCGAACGGCACTATTTCCGGGAA CACTTGCTGAAAAACTTTGACTTTGATTTTGGCTTCTGCATCCCCAGCAGTAGGAACACT TGTGAACATATCTATGAGTTTCCCCAGCTTTCGGAGGATGTCATTCGTCTAATGATTGAA AATCCTTACGAGACCCGCTCTGACAGCTTCTACTTTGTTGACAACAAGCTGATAATGCAC AACAAGGCTGATTATGCCTATAATGGAGGCCAGTAA |
Restriction Sites | NotI-NotI |
ACCN | NM_001080533 |
Insert Size | 4400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001080533.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001080533.1, NP_001074002.1 |
RefSeq Size | 4811 bp |
RefSeq ORF | 756 bp |
Locus ID | 84747 |
UniProt ID | A6NIH7 |
Gene Summary | Myristoyl-binding protein that acts as a cargo adapter: specifically binds the myristoyl moiety of a subset of N-terminally myristoylated proteins and is required for their localization. Binds myristoylated NPHP3 and plays a key role in localization of NPHP3 to the primary cilium membrane. Does not bind all myristoylated proteins. Probably plays a role in trafficking proteins in photoreceptor cells.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219902 | UNC119B (Myc-DDK-tagged)-Human unc-119 homolog B (C. elegans) (UNC119B) |
CNY 2400.00 |
|
RC219902L3 | Lenti ORF clone of Human unc-119 homolog B (C. elegans) (UNC119B), Myc-DDK-tagged |
CNY 5890.00 |
|
RC219902L4 | Lenti ORF clone of Human unc-119 homolog B (C. elegans) (UNC119B), mGFP tagged |
CNY 5890.00 |
|
RG219902 | UNC119B (tGFP-tagged) - Human unc-119 homolog B (C. elegans) (UNC119B) |
CNY 4370.00 |
其它UNC119B产品