SPI1 (NM_001080547) Human Untagged Clone
CAT#: SC315715
SPI1 (untagged)-Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1
CNY 3600.00
Cited in 2 publications. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | OF; PU.1; SFPI1; SPI-1; SPI-A |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF within SC127924 sequence for NM_003120 edited (data generated by NextGen Sequencing)
ATGTTACAGGCGTGCAAAATGGAAGGGTTTCCCCTCGTCCCCCCTCCATCAGAAGACCTG GTGCCCTATGACACGGATCTATACCAACGCCAAACGCACGAGTATTACCCCTATCTCAGC AGTGATGGGGAGAGCCATAGCGACCATTACTGGGACTTCCACCCCCACCACGTGCACAGC GAGTTCGAGAGCTTCGCCGAGAACAACTTCACGGAGCTCCAGAGCGTGCAGCCCCCGCAG CTGCAGCAGCTCTACCGCCACATGGAGCTGGAGCAGATGCACGTCCTCGATACCCCCATG GTGCCACCCCATCCCAGTCTTGGCCACCAGGTCTCCTACCTGCCCCGGATGTGCCTCCAG TACCCATCCCTGTCCCCAGCCCAGCCCAGCTCAGATGAGGAGGAGGGCGAGCGGCAGAGC CCCCCACTGGAGGTGTCTGACGGCGAGGCGGATGGCCTGGAGCCCGGGCCTGGGCTCCTG CCTGGGGAGACAGGCAGCAAGAAGAAGATCCGCCTGTACCAGTTCCTGTTGGACCTGCTC CGCAGCGGCGACATGAAGGACAGCATCTGGTGGGTGGACAAGGACAAGGGCACCTTCCAG TTCTCGTCCAAGCACAAGGAGGCGCTGGCGCACCGCTGGGGCATCCAGAAGGGCAACCGC AAGAAGATGACCTACCAGAAGATGGCGCGCGCGCTGCGCAACTACGGCAAGACGGGCGAG GTCAAGAAGGTGAAGAAGAAGCTCACCTACCAGTTCAGCGGCGAAGTGCTGGGCCGCGGG GGCCTGGCCGAGCGGCGCCACCCGCCCCACTGA Clone variation with respect to NM_003120.2 |
Restriction Sites | NotI-NotI |
ACCN | NM_001080547 |
Insert Size | 1500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001080547.1, NP_001074016.1 |
RefSeq Size | 1426 bp |
RefSeq ORF | 816 bp |
Locus ID | 6688 |
UniProt ID | P17947 |
Protein Families | Transcription Factors |
Protein Pathways | Acute myeloid leukemia, Pathways in cancer |
Gene Summary | This gene encodes an ETS-domain transcription factor that activates gene expression during myeloid and B-lymphoid cell development. The nuclear protein binds to a purine-rich sequence known as the PU-box found near the promoters of target genes, and regulates their expression in coordination with other transcription factors and cofactors. The protein can also regulate alternative splicing of target genes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Hepatitis C Virus Induced Changes in miRNA-107 and miRNA-449a Modulate CCL2 by Targeting IL6 Receptor Complex in Hepatitis
,Sarma, NJ;Tiriveedhi, V;Crippin, JS;Chapman, WC;Mohanakumar, T;,
J. Virol., Jan 2014.
,PubMed ID 24429361
[SPI1]
|
PU.1 and C/EBPa synergistically program distinct response to NF-{kappa}B activation through establishing monocyte specific enhancers
,Fulai Jin, Yan Li, Bing Ren, and Rama Natarajan,
PNAS, Mar 2011; 108: 5290 - 5295
[SPI1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217488 | SPI1 (Myc-DDK-tagged)-Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1 |
CNY 2400.00 |
|
RC217488L1 | Lenti ORF clone of Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
RC217488L2 | Lenti ORF clone of Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1, mGFP tagged |
CNY 4800.00 |
|
RC217488L3 | Lenti ORF clone of Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1, Myc-DDK-tagged |
CNY 4800.00 |
|
RC217488L4 | Lenti ORF clone of Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1, mGFP tagged |
CNY 4800.00 |
|
RG217488 | SPI1 (tGFP-tagged) - Human spleen focus forming virus (SFFV) proviral integration oncogene spi1 (SPI1), transcript variant 1 |
CNY 4000.00 |