AKR1B15 (NM_001080538) Human Untagged Clone

CAT#: SC315736

AKR1B15 (untagged)-Human aldo-keto reductase family 1, member B15 (AKR1B15)



  "NM_001080538" in other vectors (4)

CNY 5610.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-AKR1B15 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AK1R1B7; AKR1B10L; AKR1R1B7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315736 representing NM_001080538.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTCTTACAAATGGAACCCCAAGTGAACTCAACTAACAACTTCCACCAAGGACCCCTGGACCAACCC
GTTGGCCCTTTGACTGGCCTAAAGAGTTCCCTTCTGAAGGACACTACAAGTGCAGGGCCCCTTCTTCGC
CCCTATCCAGCATCTCTTCTCGGCAAAGTGAAAGAAGCGGTGAAGGTGGCCATTGATGCAGAATATCGC
CACATTGACTGTGCCTATTTCTATGAGAATCAACATGAGGTGGGAGAAGCCATCCAAGAGAAGATCCAA
GAGAAGGCTGTGATGCGGGAGGACCTGTTCATCGTCAGCAAGGTGTGGCCCACTTTCTTTGAGAGACCC
CTTGTGAGGAAAGCCTTTGAGAAGACCCTCAAGGACCTGAAGCTGAGCTATCTGGACGTCTATCTTATT
CACTGGCCACAGGGATTCAAGACTGGGGATGACTTTTTCCCCAAAGATGATAAAGGTAATATGATCAGT
GGAAAAGGAACGTTCTTGGATGCCTGGGAGGCCATGGAGGAGCTGGTGGACGAGGGGCTGGTGAAAGCC
CTTGGGGTCTCAAATTTCAACCACTTCCAGATCGAGAGGCTCTTGAACAAACCTGGACTGAAATATAAA
CCAGTGACTAACCAGGTTGAGTGTCACCCATACCTCACGCAGGAGAAACTGATCCAGTACTGCCACTCC
AAGGGCATCACCGTTACGGCCTACAGCCCCCTGGGCTCTCCGGATAGACCTTGGGCCAAACCTGAGGAC
CCTTCCCTGCTGGAGGATCCCAAGATTAAGGAGATTGCTGCAAAGCACAAAAAAACCACAGCCCAGGTT
CTGATCCGTTTCCATATCCAGAGGAATGTGACAGTGATCCCCAAGTCTATGACACCAGCACACATTGTT
GAGAACATTCAGGTCTTTGACTTTAAATTGAGTGATGAGGAGATGGCAACCATACTCAGCTTCAACAGA
AACTGGAGGGCCTTTGACTTCAAGGAATTCTCTCATTTGGAGGACTTTCCCTTCGATGCAGAATATTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001080538
Insert Size 1035 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001080538.2
RefSeq Size 1625 bp
RefSeq ORF 1035 bp
Locus ID 441282
UniProt ID C9JRZ8
MW 39.5 kDa
Gene Summary Isoform 1: Catalyzes the NADPH-dependent reduction of a variety of carbonyl substrates, like aromatic aldehydes, alkenals, ketones and alpha-dicarbonyl compounds (PubMed:26222439, PubMed:21276782). In addition, catalyzes the reduction of androgens and estrogens with high positional selectivity (shows 17-beta-hydroxysteroid dehydrogenase activity) as well as 3-keto-acyl-CoAs (PubMed:25577493). Displays strong enzymatic activity toward all-trans-retinal and 9-cis-retinal (PubMed:26222439). May play a physiological role in retinoid metabolism (PubMed:26222439).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (a). Variants 1 and 2 both encode the same isoform (a). ##RefSeq-Attributes-START## MANE Ensembl match :: ENST00000457545.7/ ENSP00000389289.1 RefSeq Select criteria :: based on expression, longest protein ##RefSeq-Attributes-END## COMPLETENESS: full length.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...