DMP1 (NM_001079911) Human Untagged Clone

CAT#: SC315785

DMP1 (untagged)-Human dentin matrix acidic phosphoprotein 1 (DMP1), transcript variant 2



  "NM_001079911" in other vectors (4)

CNY 7980.00


货期*
2周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Goat Anti-DMP1 Antibody
    • 100 ug

CNY 5371.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARHP; ARHR; DMP-1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001079911, the custom clone sequence may differ by one or more nucleotides


ATGAAGATCAGCATCCTGCTCATGTTCCTTTGGGGATTATCCTGTGCTCTCCCAGTAACCAGGTATCAAA
ATAATGAATCTGAGGATTCTGAAGAATGGAAGGGTCATTTGGCTCAGGCACCAACACCACCCTTGGCAAA
TGAAGACCCCAGTGACAGCACTCAGTCAGAGGAGGGCCTGGGCTCTGATGATCATCAATACATTTATAGG
CTAGCTGGTGGCTTCTCCAGGAGCACAGGAAAAGGAGGAGATGATAAAGATGACGATGAAGATGACAGTG
GAGATGACACCTTTGGTGACGATGACAGTGGCCCAGGGCCCAAAGACAGACAAGAAGGAGGAAACTCCAG
ACTGGGAAGTGATGAGGACTCTGATGACACCATACAAGCCAGTGAAGAGAGTGCCCCACAAGGGCAAGAC
AGTGCCCAAGATACCACCAGTGAGAGCAGGGAACTTGACAATGAGGACCGGGTGGACAGCAAGCCTGAGG
GAGGTGACTCCACTCAAGAGAGTGAGAGTGAAGAGCACTGGGTGGGAGGTGGCAGTGATGGGGAGAGCAG
CCATGGAGACGGCTCCGAGTTGGACGATGAGGGAATGCAGAGTGATGACCCAGAGAGCATCAGGAGTGAA
AGGGGAAACTCCAGAATGAACAGTGCAGGCATGAAATCAAAAGAATCTGGAGAAAACAGTGAGCAAGCAA
ACACTCAAGATTCAGGTGGCAGCCAATTGCTGGAGCATCCCAGTAGGAAAATTTTTAGGAAGTCTCGCAT
CTCAGAGGAAGATGACAGAAGCGAGCTTGATGACAACAACACAATGGAAGAAGTCAAGAGTGACTCTACA
GAAAACAGCAACTCCAGAGACACTGGCCTCAGCCAACCCAGGAGAGACAGCAAGGGTGACTCTCAAGAAG
ACAGCAAGGAGAATCTGTCCCAGGAAGAGAGCCAAAACGTAGATGGTCCCAGCAGTGAGTCCAGCCAAGA
GGCCAACCTGTCATCTCAAGAGAACAGCAGTGAGTCTCAGGAAGAGGTGGTGAGTGAGTCCAGGGGAGAT
AACCCCGACCCCACAACTAGTTATGTAGAAGACCAGGAAGACAGTGACTCCAGCGAGGAGGACAGCTCGC
ACACACTCTCCCACTCAAAAAGTGAATCCAGAGAGGAGCAAGCAGACAGCGAATCCAGTGAGAGCCTCAA
CTTCTCAGAGGAAAGCCCGGAGTCCCCTGAGGATGAGAACAGCTCCAGCCAGGAGGGCCTCCAGTCTCAC
AGCAGCTCAGCAGAGAGTCAGAGCGAGGAAAGCCATTCTGAGGAAGACGACAGTGACTCTCAAGACAGCA
GCAGATCCAAAGAAGATAGCAACTCCACGGAGAGCAAATCAAGCAGTGAGGAAGATGGCCAGTTGAAAAA
CATTGAGATAGAGAGCCGGAAATTAACAGTTGATGCCTATCACAACAAACCCATTGGGGACCAAGATGAC
AATGACTGCCAAGACGGCTATTAG


Restriction Sites Please inquire     
ACCN NM_001079911
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001079911.1, NP_001073380.1
RefSeq Size 2631 bp
RefSeq ORF 1494 bp
Locus ID 1758
UniProt ID Q13316
Protein Families Secreted Protein
Gene Summary Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an internal in-frame exon, compared to variant 1, resulting in a protein (isoform 2) that is 16 aa shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments and data in PMID:15108359.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...