NAA60 (NM_001083600) Human Untagged Clone

CAT#: SC316047

NAA60 (untagged)-Human N-acetyltransferase 15 (GCN5-related, putative) (NAT15), transcript variant 3



  "NM_001083600" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
NAA60 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HAT4; hNaa60; NAT15; NatF
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316047 representing NM_001083600.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACAGAGGTGGTGCCATCCAGCGCGCTCAGCGAGGTCAGCCTGCGCCTCCTCTGCCACGATGACATA
GACACTGTGAAGCACCTGTGTGGCGACTGGTTCCCCATCGAGTACCCAGACTCATGGTATCGTGATATC
ACATCCAACAAGAAGTTCTTTTCCCTTGCTGCAACCTACAGAGGTGCCATTGTGGGAATGATAGTAGCT
GAAATTAAGAACAGGACCAAAATACATAAAGAGGATGGAGATATTCTAGCATCCAACTTCTCTGTTGAC
ACACAAGTCGCGTACATCCTAAGTCTGGGCGTCGTGAAAGAGTTCAGGAAGCACGGCATAGGTTCCCTC
TTACTTGAAAGTTTAAAGGATCACATATCAACCACCGCCCAGGACCACTGCAAAGCCATTTACCTGCAT
GTCCTCACCACCAACAACACAGCAATAAACTTCTATGAAAACAGAGACTTCAAGCAGCACCACTATCTC
CCCTATTACTACTCCATTCGAGGGGTCCTCAAAGATGGCTTCACCTATGTCCTCTACATCAACGGCGGC
CACCCTCCCTGGACGATTTTGGACTACATCCAGCACCTGGGCTCTGCACTAGCCAGCCTGAGCCCCTGC
TCCATTCCGCACAGAGTCTACCGCCAGGCCCACAGCCTGCTCTGCAGCTTCCTGCCATGGTCGGGCATC
TCTTCCAAGAGTGGCATCGAGTACAGCCGGACCATGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001083600
Insert Size 729 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001083600.2
RefSeq Size 2649 bp
RefSeq ORF 729 bp
Locus ID 79903
UniProt ID Q9H7X0
MW 27.5 kDa
Gene Summary This gene encodes an enzyme that localizes to the Golgi apparatus, where it transfers an acetyl group to the N-terminus of free proteins. This enzyme acts on histones, and its activity is important for chromatin assembly and chromosome integrity. Alternative splicing and the use of alternative promoters results in multiple transcript variants. The upstream promoter is located in a differentially methylated region (DMR) and undergoes imprinting; transcript variants originating from this position are expressed from the maternal allele. [provided by RefSeq, Nov 2015]
Transcript Variant: This variant (3) represents use of an alternate promoter and differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...