E2F5 (NM_001083588) Human Untagged Clone
CAT#: SC316052
E2F5 (untagged)-Human E2F transcription factor 5, p130-binding (E2F5), transcript variant 2
CNY 5610.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | E2F-5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316052 representing NM_001083588.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCGGCAGAGCCCGCGAGCTCGGGCCAGCAGGCGCCGGCAGGGCAGGGGCAGGGCCAGCGGCCG CCGCCGCAGCCTCCGCAGGCGCAAGCCCCGCAGCCGCCCCCGCCGCCGCAGCTCGGGGGCGCCGGGGGC GGCAGCAGCAGGCACGAGAAGAGCCTGGGGCTGCTCACTACCAAGTTCGTGTCGCTGCTGCAGGAGGCC AAGGACGGCGTTCTGGATCTCAAAGCGGCTGCTGATACTTTGGCTGTGAGGCAAAAAAGGAGAATTTAT GATATCACCAATGTCTTAGAGGGAATTGACTTGATTGAAAAAAAGTCAAAAAACAGTATCCAGTGGAAA GGTGTAGGTGCTGGCTGTAATACTAAAGAAGTCATAGATAGATTAAGATATCTTAAAGCTGAAATTGAA GATCTAGAACTGAAGGAAAGAGAACTTGATCAGCAGAAGTTGTGGCTACAGCAAAGCATCAAAAATGTG ATGGACGATTCCATTAATAATAGATTTTCCTATGTAACTCATGAAGACATCTGTAATTGCTTTAATGGT GATACACTTTTGGCCATTCAGGCACCTTCTGGTACACAACTGGAGGTACCCATTCCAGAAATGGGTCAG AATGGACAAAAGAAATACCAGATCAATCTAAAGAGTCATTCAGGACCTATCCATGTGCTGCTTATAAAT AAAGAGTCGAGTTCATCTAAGCCCGTGGTTTTTCCTGTTCCCCCACCTGATGACCTCACACAGCCTTCC TCCCAGTCCTTGACTCCAGTGACTCCACAGAAATCCAGCATGGCAACTCAAAATCTGCCTGAGCAACAT GTCTCTGAAAGAAGCCAGGCTCTGCAGCAGACATCAGCTACAGATATATCTTCAGGATCTATTAGTGGA GATATCATTGATGAGTTAATGTCTTCTGACGTGTTTCCTCTCTTAAGGCTTTCTCCTACCCCGGCAGAT GACTACAACTTTAATTTAGATGATAACGAAGGAGTTTGTGATCTGTTTGATGTCCAGATACTAAATTAT TAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001083588 |
Insert Size | 1038 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001083588.1 |
RefSeq Size | 1740 bp |
RefSeq ORF | 1038 bp |
Locus ID | 1875 |
UniProt ID | Q15329 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Cell cycle, TGF-beta signaling pathway |
MW | 37.5 kDa |
Gene Summary | The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionarily conserved domains that are present in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein is differentially phosphorylated and is expressed in a wide variety of human tissues. It has higher identity to E2F4 than to other family members. Both this protein and E2F4 interact with tumor suppressor proteins p130 and p107, but not with pRB. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1, resulting in a shorter protein (isoform 2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221587 | E2F5 (Myc-DDK-tagged)-Human E2F transcription factor 5, p130-binding (E2F5), transcript variant 2 |
CNY 3656.00 |
|
RC221587L3 | Lenti ORF clone of Human E2F transcription factor 5, p130-binding (E2F5), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC221587L4 | Lenti ORF clone of Human E2F transcription factor 5, p130-binding (E2F5), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG221587 | E2F5 (tGFP-tagged) - Human E2F transcription factor 5, p130-binding (E2F5), transcript variant 2 |
CNY 4370.00 |