United States
Germany
Japan
United Kingdom
China
TMEM150B (NM_001085488) Human Untagged Clone
CAT＃: SC316163
TMEM150B (untagged)-Human transmembrane protein 150B (TMEM150B)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DRAM3; TMEM224; TTN2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001085488 edited
ATGTGGGGCTACCTGTCGCTGATGCCTGTCTTCCTAGCTGTCTGGGCTATCTCTGGCGTC TGGATCGTTTTTGCCATTGCAGTGACCAACAGGACTGTGGACCTCAGTAAAGGCTTTCCC TACATCAGCATCTGCGGATCCTTCCCCCCTCAGAGCTGCATCTTCAGCCAGGTGCTCAAT ATGGGAGCTGCTCTGGCCGCGTGGATCTGCATTGTCCGTTACCACCAGCTCCGGGACTGG GGCGTCAGAAGGTGGCCTAACCAGCTGATCCTATGGACGGGTCTTCTGTGTGCCCTGGGC ACCTCCGTGGTAGGCAATTTCCAGGAAAAGAACCAGCGGCCTACGCACTTGGCAGGGGCC TTCCTTGCCTTCATCTTGGGTAACGTCTACTTCTGGCTGCAGCTCCTCCTGTGGAGGCTG AAGAGGCTGCCCCAGCCCGGGGCTGCCTGGATTGGGCCCCTCCGCCTGGGCCTCTGCAGC GTCTGCACCATCCTCATTGTGGCCATGATCGTCCTCCACGCCTGCTCGCTGCGTAGCGTC TCTGCGGCCTGCGAGTGGGTCGTGGCCATGCTGCTGTTCGCGCTCTTCGGTCTCTTAGCC GTTGACTTCTCCGCCCTGGAGAGCTGCACCCTGTGTGTTCAGCCGTGGCCCAGCCTCAGC CCCCCGCCGGCCTCCCCCATCTCCCTGCCGGTCCAGCTGTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001085488 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001085488. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001085488.1, NP_001078957.1 |
| RefSeq Size | 875 bp |
| RefSeq ORF | 702 bp |
| Locus ID | 284417 |
| UniProt ID | A6NC51 |
| Protein Families | Transmembrane |
| Gene Summary | This gene encodes a protein that belongs to the DRAM (damage-regulated autophagy modulator) family of membrane-spanning proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013] Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein (isoform a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216438 | TMEM150B (Myc-DDK-tagged)-Human transmembrane protein 150B (TMEM150B) |
CNY 2,400.00 |
|
| RC216438L3 | Lenti ORF clone of Human transmembrane protein 150B (TMEM150B), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC216438L4 | Lenti ORF clone of Human transmembrane protein 150B (TMEM150B), mGFP tagged |
CNY 5,890.00 |
|
| RG216438 | TMEM150B (tGFP-tagged) - Human transmembrane protein 150B (TMEM150B) |
CNY 4,370.00 |
其它TMEM150B产品
