SFTPA1 (NM_001093770) Human Untagged Clone

CAT#: SC316168

SFTPA1 (untagged)-Human surfactant protein A1 (SFTPA1), transcript variant 2



  "NM_001093770" in other vectors (5)

CNY 3600.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
Anti-SFTPA1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms COLEC4; PSAP; PSP-A; PSPA; SFTP1; SFTPA1B; SP-A; SP-A1; SP-A1 beta; SP-A1 delta; SP-A1 epsilon; SP-A1 gamma; SPA; SPA1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001093770 edited
ATGAGGCCATGCCAGGTGCCAGGAGCAGCGACTGGACCCAGAGCCATGTGGCTGTGCCCT
CTGGCCCTCAACCTCATCTTGATGGCAGCCTCTGGTGCTGTGTGCGAAGTGAAGGACGTT
TGTGTTGGAAGCCCTGGTATCCCCGGCACTCCTGGATCCCACGGCCTGCCAGGCAGGGAC
GGGAGAGATGGTCTCAAAGGAGACCCTGGCCCTCCAGGCCCCATGGGTCCACCTGGAGAA
ATGCCATGTCCTCCTGGAAATGATGGGCTGCCTGGAGCCCCTGGTATCCCTGGAGAGTGT
GGAGAGAAGGGGGAGCCTGGCGAGAGGGGCCCTCCAGGGCTTCCAGCTCATCTAGATGAG
GAGCTCCAAGCCACACTCCACGACTTTAGACATCAAATCCTGCAGACAAGGGGAGCCCTC
AGTCTGCAGGGCTCCATAATGACAGTAGGAGAGAAGGTCTTCTCCAGCAATGGGCAGTCC
ATCACTTTTGATGCCATTCAGGAGGCATGTGCCAGAGCAGGCGGCCGCATTGCTGTCCCA
AGGAATCCAGAGGAAAATGAGGCCATTGCAAGCTTCGTGAAGAAGTACAACACATATGCC
TATGTAGGCCTGACTGAGGGTCCCAGCCCTGGAGACTTCCGCTACTCAGACGGGACCCCT
GTAAACTACACCAACTGGTACCGAGGGGAGCCCGCAGGTCGGGGAAAAGAGCAGTGTGTG
GAGATGTACACAGATGGGCAGTGGAATGACAGGAACTGCCTGTACTCCCGACTGACCATC
TGTGAGTTCTGA
Restriction Sites Please inquire     
ACCN NM_001093770
Insert Size 800 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001093770.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001093770.1, NP_001087239.1
RefSeq Size 1311 bp
RefSeq ORF 738 bp
Locus ID 653509
UniProt ID Q8IWL2
Gene Summary This gene encodes a lung surfactant protein that is a member of a subfamily of C-type lectins called collectins. The encoded protein binds specific carbohydrate moieties found on lipids and on the surface of microorganisms. This protein plays an essential role in surfactant homeostasis and in the defense against respiratory pathogens. Mutations in this gene are associated with idiopathic pulmonary fibrosis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Transcript Variant: This variant (2) differs in the 5' UTR and includes an additional segment in the 5' coding region, compared to variant 1. The encoded isoform (2) has a longer and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...