SEPP1 (SELENOP) (NM_001085486) Human Untagged Clone
CAT#: SC316197
SEPP1 (untagged)-Human selenoprotein P, plasma, 1 (SEPP1), transcript variant 2 (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)
CNY 7220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Synonyms | SELP; SeP; SEPP; SEPP1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC316197 representing NM_001085486.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGGAGAAGCCTGGGGCTTGCCCTGGCTCTCTGTCTCCTCCCATCGGGAGGAACAGAGAGCCAGGAC CAAAGCTCCTTATGTAAGCAACCCCCAGCCTGGAGCATAAGAGATCAAGATCCAATGCTAAACTCCAAT GGTTCAGTGACTGTGGTTGCTCTTCTTCAAGCCAGCTGATACCTGTGCATACTGCAGGCATCTAAATTA GAAGACCTGCGAGTAAAACTGAAGAAAGAAGGATATTCTAATATTTCTTATATTGTTGTTAATCATCAA GGAATCTCTTCTCGATTAAAATACACACATCTTAAGAATAAGGTTTCAGAGCATATTCCTGTTTATCAA CAAGAAGAAAACCAAACAGATGTCTGGACTCTTTTAAATGGAAGCAAAGATGACTTCCTCATATATGAT AGATGTGGCCGTCTTGTATATCATCTTGGTTTGCCTTTTTCCTTCCTAACTTTCCCATATGTAGAAGAA GCCATTAAGATTGCTTACTGTGAAAAGAAATGTGGAAACTGCTCTCTCACGACTCTCAAAGATGAAGAC TTTTGTAAACGTGTATCTTTGGCTACTGTGGATAAAACAGTTGAAACTCCATCGCCTCATTACCATCAT GAGCATCATCACAATCATGGACATCAGCACCTTGGCAGCAGTGAGCTTTCAGAGAATCAGCAACCAGGA GCACCAAATGCTCCTACTCATCCTGCTCCTCCAGGCCTTCATCACCACCATAAGCACAAGGGTCAGCAT AGGCAGGGTCACCCAGAGAACCGAGATATGCCAGCAAGTGAAGATTTACAAGATTTACAAAAGAAGCTC TGTCGAAAGAGATGTATAAATCAATTACTCTGTAAATTGCCCACAGATTCAGAGTTGGCTCCTAGGAGC TGATGCTGCCATTGTCGACATCTGATATTTGAAAAAACAGGGTCTGCAATCACCTGACAGTGTAAAGAA AACCTCCCATCTTTATGTAGCTGACAGGGACTTCGGGCAGAGGAGAACATAACTGAATCTTGTCAGTGA CGTTTGCCTCCAGCTGCCTGACAAATAAGTCAGCAGCTTATACCCACAGAAGCCAGTGCCAGTTGACGC TGAAAGAATCAGGCAAAAAAGTGAGAATGACCTTCAAACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001085486 |
| Insert Size | 1146 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). The expression of this clone is not guaranteed due to the nature of selenoproteins. |
| OTI Annotation | This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001085486.1 |
| RefSeq Size | 2193 bp |
| RefSeq ORF | 1146 bp |
| Locus ID | 6414 |
| UniProt ID | P49908 |
| Protein Families | Secreted Protein |
| MW | 42.9 kDa |
| Gene Summary | This gene encodes a selenoprotein that is predominantly expressed in the liver and secreted into the plasma. This selenoprotein is unique in that it contains multiple selenocysteine (Sec) residues per polypeptide (10 in human), and accounts for most of the selenium in plasma. It has been implicated as an extracellular antioxidant, and in the transport of selenium to extra-hepatic tissues via apolipoprotein E receptor-2 (apoER2). Mice lacking this gene exhibit neurological dysfunction, suggesting its importance in normal brain function. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The mRNA for this selenoprotein contains two SECIS elements. The use of alternative polyadenylation sites, one located in between the two SECIS elements, results in two populations of mRNAs containing either both (predominant) or just the upstream SECIS element (PMID:27881738). Alternatively spliced transcript variants have also been found for this gene. [provided by RefSeq, Oct 2018] Transcript Variant: This variant (2, also known as Sepp1c) contains an additional 5' non-coding exon, and thus has a different and longer 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218097 | SEPP1 (Myc-DDK-tagged)-Human selenoprotein P, plasma, 1 (SEPP1), transcript variant 2, (Note, selenocysteine protein, internal stop codon, see reference data summary) |
CNY 3816.00 |
|
| RG218097 | SEPP1 (GFP-tagged) - Human selenoprotein P, plasma, 1 (SEPP1), transcript variant 2, (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below) |
CNY 4370.00 |
