MIA40 (CHCHD4) (NM_001098502) Human Untagged Clone
CAT#: SC316333
CHCHD4 (untagged)-Human coiled-coil-helix-coiled-coil-helix domain containing 4 (CHCHD4), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 3990.00
Cited in 2 publications. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MIA40; TIMM40 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316333 representing NM_001098502.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCTATTGCCGGCAGGAAGGGAAGGATCGAATCATATTTGTAACCAAAGAAGATCATGAAACTCCA AGCAGTGCAGAATTGGTGGCTGATGACCCCAACGATCCATACGAGGAGCATGGATTGATACTGCCAAAT GGAAACATTAACTGGAACTGCCCATGCCTTGGGGGAATGGCCAGCGGTCCCTGTGGAGAACAGTTTAAG TCAGCCTTTTCCTGCTTCCACTATAGCACGGAGGAGATCAAGGGGTCAGACTGTGTAGACCAGTTCCGG GCCATGCAGGAATGCATGCAGAAATACCCAGACCTCTATCCCCAAGAGGATGAGGATGAGGAAGAGGAA AGAGAGAAGAAGCCAGCAGAACAAGCAGAAGAAACAGCTCCCATTGAGGCCACTGCAACCAAAGAAGAG GAGGGATCAAGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001098502 |
Insert Size | 429 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001098502.1 |
RefSeq Size | 1476 bp |
RefSeq ORF | 429 bp |
Locus ID | 131474 |
UniProt ID | Q8N4Q1 |
MW | 16 kDa |
Gene Summary | CHCHD4, a component of human mitochondria, belongs to a protein family whose members share 6 highly conserved cysteine residues constituting a -CXC-CX(9)C-CX(9)C- motif in the C terminus (Hofmann et al., 2005 [PubMed 16185709]).[supplied by OMIM, Mar 2008] Transcript Variant: This variant (1) is the predominant transcript. It does not contain an N-terminal, cleavable mitochondrial target sequence, yet experimental studies have determined that the encoded protein (isoform 1) is found within the intermembrane space of the mitochondrion. |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Targeting and Import Mechanism of Coiled-coil Helix Coiled-coil Helix Domain-containing Protein 3 (ChChd3) into the Mitochondrial Intermembrane Space *
,null,
The Journal of Biological Chemistry
,PubMed ID 23019327
[CHCHD4]
|
Targeting and Import Mechanism of Coiled-coil Helix Coiled-coil Helix Domain-containing Protein 3 (ChChd3) into the Mitochondrial Intermembrane Space
,Manjula Darshi, Kristina N. Trinh, Anne N. Murphy, and Susan S. Taylor,
J. Biol. Chem., Nov 2012; 287: 39480 - 39491.
[CHCHD4]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217831 | CHCHD4 (Myc-DDK-tagged)-Human coiled-coil-helix-coiled-coil-helix domain containing 4 (CHCHD4), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 1800.00 |
|
RC217831L1 | Lenti ORF clone of Human coiled-coil-helix-coiled-coil-helix domain containing 4 (CHCHD4), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 4200.00 |
|
RC217831L2 | Lenti ORF clone of Human coiled-coil-helix-coiled-coil-helix domain containing 4 (CHCHD4), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 5890.00 |
|
RC217831L3 | Lenti ORF clone of Human coiled-coil-helix-coiled-coil-helix domain containing 4 (CHCHD4), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 5890.00 |
|
RC217831L4 | Lenti ORF clone of Human coiled-coil-helix-coiled-coil-helix domain containing 4 (CHCHD4), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 4200.00 |
|
RG217831 | CHCHD4 (tGFP-tagged) - Human coiled-coil-helix-coiled-coil-helix domain containing 4 (CHCHD4), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 3400.00 |