TTC9 (NM_015351) Human Untagged Clone
CAT＃: SC316488
TTC9 (untagged)-Human tetratricopeptide repeat domain 9 (TTC9)
CNY 3600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | TTC9A |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC316488 representing NM_015351.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGAGAAAGGGCTCGGCGGCCGGGGCCAAGGGGAACCCGAGCCCGCCCGCGGCCGGAGAGGGGCAG CGGCCACCGCCGCCGCTGTGCGTCCCGGGCGGCGGCGGAGGAGCCCCAGCGAGGGGCCAGGTCGGGGCG GCGGCCGAGCCGGCCGAGCTCATCCGACGAGCGCACGAGTTCAAAAGCCAAGGGGCGCAGTGCTACAAG GACAAGAAATTCCGTGAAGCCATAGGCAAATACCACCGGGCGTTGCTGGAGCTGAAGGGGCTGCTGCCG CCCCCCGGGGAACGGGAGCGGGACTCGCGCCCGGCCTCCCCGGCTGGGGCCCTGAAGCCCGGCCGCCTC TCGGAGGAGCAGAGCAAGACGGTGGAAGCCATCGAGATCGACTGTTACAACAGCCTGGCAGCCTGCCTG CTCCAGGCTGAGCTGGTAAACTATGAACGAGTCAAGGAATATTGCCTCAAAGTCTTGAAGAAGGAAGGG GAGAACTTCAAGGCCCTTTACCGGTCTGGTGTGGCCTTCTACCACCTTGGGGACTATGACAAAGCACTC TACTACCTGAAAGAAGCAAGGACCCAACAACCAACAGACACCAACGTGATTCGGTATATCCAGCTGACG GAGATGAAACTCAGCCGATGCTCCCAGAGAGAAAAAGAAGCCATGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_015351 |
| Insert Size | 669 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_015351.1 |
| RefSeq Size | 5217 bp |
| RefSeq ORF | 669 bp |
| Locus ID | 23508 |
| UniProt ID | Q92623 |
| MW | 24.4 kDa |
| Gene Summary | This gene encodes a protein that contains three tetratricopeptide repeats. The gene has been shown to be hormonally regulated in breast cancer cells and may play a role in cancer cell invasion and metastasis. [provided by RefSeq, Mar 2009] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220249 | TTC9 (Myc-DDK-tagged)-Human tetratricopeptide repeat domain 9 (TTC9) |
CNY 3600.00 |
|
| RC220249L1 | Lenti ORF clone of Human tetratricopeptide repeat domain 9 (TTC9), Myc-DDK-tagged |
CNY 6000.00 |
|
| RC220249L2 | Lenti ORF clone of Human tetratricopeptide repeat domain 9 (TTC9), mGFP tagged |
CNY 5890.00 |
|
| RC220249L3 | Lenti ORF clone of Human tetratricopeptide repeat domain 9 (TTC9), Myc-DDK-tagged |
CNY 5890.00 |
|
| RC220249L4 | Lenti ORF clone of Human tetratricopeptide repeat domain 9 (TTC9), mGFP tagged |
CNY 5890.00 |
|
| RG220249 | TTC9 (tGFP-tagged) - Human tetratricopeptide repeat domain 9 (TTC9) |
CNY 4370.00 |
