SGCE (NM_001099401) Human Untagged Clone

CAT#: SC316529

SGCE (untagged)-Human sarcoglycan, epsilon (SGCE), transcript variant 1



  "NM_001099401" in other vectors (4)

CNY 3656.00

CNY 7320.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-SGCE Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DYT11; epsilon-SG; ESG
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>SC316529 representing NM_001099401.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGCAATTGCCCCGGTGGTGGGAGCTGGGAGACCCCTGTGCTTGGACGGGACAGGGTCGGGGGACACGC
AGGATGAGCCCCGCGACCACTGGCACATTCTTGCTGACAGTGTACAGTATTTTCTCCAAGGTACACTCC
GATCGGAATGTATACCCATCAGCAGGTGTCCTCTTTGTTCATGTTTTGGAAAGAGAATATTTTAAGGGG
GAATTTCCACCTTACCCAAAACCTGGCGAGATTAGTAATGATCCCATAACATTTAATACAAATTTAATG
GGTTACCCAGACCGACCTGGATGGCTTCGATATATCCAAAGGACACCATATAGTGATGGAGTCCTATAT
GGGTCCCCAACAGCTGAAAATGTGGGGAAGCCAACAATCATTGAGATAACTGCCTACAACAGGCGCACC
TTTGAGACTGCAAGGCATAATTTGATAATTAATATAATGTCTGCAGAAGACTTCCCGTTGCCATATCAA
GCAGAATTCTTCATTAAGAATATGAATGTAGAAGAAATGTTGGCCAGTGAGGTTCTTGGAGACTTTCTT
GGCGCAGTGAAAAATGTGTGGCAGCCAGAGCGCCTGAACGCCATAAACATCACATCGGCCCTAGACAGG
GGTGGCAGGGTGCCACTTCCCATTAATGACCTGAAGGAGGGCGTTTATGTCATGGTTGGTGCAGATGTC
CCGTTTTCTTCTTGTTTACGAGAAGTTGAAAATCCACAGAATCAATTGAGATGTAGTCAAGAAATGGAG
CCTGTAATAACATGTGATAAAAAATTTCGTACTCAATTTTACATTGACTGGTGCAAAATTTCATTGGTT
GATAAAACAAAGCAAGTGTCCACCTATCAGGAAGTGATTCGTGGAGAGGGGATTTTACCTGATGGTGGA
GAATACAAACCCCCTTCTGATTCTTTGAAAAGCAGAGACTATTACACGGATTTCCTAATTACACTGGCT
GTGCCCTCGGCAGTGGCACTGGTCCTTTTTCTAATACTTGCTTATATCATGTGCTGCCGACGGGAAGGC
GTGGAAAAGAGAAACATGCAAACACCAGACATCCAACTGGTCCATCACAGTGCTATTCAGAAATCTACC
AAGGAGCTTCGAGACATGTCCAAGAATAGAGAGATAGCATGGCCCCTGTCAACGCTTCCTGTGTTCCAC
CCTGTGACTGGGGAAATCATACCTCCTTTACACACAGACAACTATGATAGCACAAACATGCCATTGATG
CAAACGCAGCAATGGAGTTTCGCTCCTGTTGCCCAGGCTGGAGTGCAATGGAGCGATCTTGGCTCACTG
CAGCCTCCGCCTCCCAGGAACTTGCCACATCAGACTCAGATTCCCCAACAGCAGACTACAGGTAAATGG
TATCCCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001099401
Insert Size 1389 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001099401.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001099401.1
RefSeq Size 1784 bp
RefSeq ORF 1389 bp
Locus ID 8910
UniProt ID O43556
Protein Families Transmembrane
MW 52.5 kDa
Gene Summary This gene encodes the epsilon member of the sarcoglycan family. Sarcoglycans are transmembrane proteins that are components of the dystrophin-glycoprotein complex, which link the actin cytoskeleton to the extracellular matrix. Unlike other family members which are predominantly expressed in striated muscle, the epsilon sarcoglycan is more broadly expressed. Mutations in this gene are associated with myoclonus-dystonia syndrome. This gene is imprinted, with preferential expression from the paternal allele. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. A pseudogene associated with this gene is located on chromosome 2. [provided by RefSeq, Oct 2016]
Transcript Variant: This variant (1) lacks an alternate in-frame exon in the 5' coding region and contains an additional in-frame exon in the 3' coding region, compared to variant 5. It encodes isoform 1, which shares the same termini, but is shorter than isoform 5.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...