ARMS2 (NM_001099667) Human Untagged Clone
CAT#: SC316643
ARMS2 (untagged)-Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein
CNY 1200.00
CNY 3990.00
Product images
CNY 1999.00
CNY 2700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ARMD8 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001099667 edited
GTCCCTGTACCCTACATGCTGCGCCTATACCCAGGACCGATGGTAACTGAGGCGGAGGGG AAAGGAGGGCCTGAGATGGCAAGTCTGTCCTCCTCGGTGGTTCCTGTGTCCTTCATTTCC ACTCTGCGAGAGTCTGTGCTGGACCCTGGAGTTGGTGGAGAAGGAGCCAGTGACAAGCAG AGGAGCAAACTGTCTTTATCACACTCCATGATCCCAGCTGCTAAAATCCACACTGAGCTC TGCTTACCAGCCTTCTTCTCTCCTGCTGGAACCCAGAGGAGGTTCCAGCAGCCTCAGCAC CACCTGACACTGTCTATCATCCACACTGCAGCAAGGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001099667 |
| Insert Size | 350 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | It is not a varient. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001099667.1, NP_001093137.1 |
| RefSeq Size | 823 bp |
| RefSeq ORF | 324 bp |
| Locus ID | 387715 |
| UniProt ID | P0C7Q2 |
| Gene Summary | This gene encodes a small secreted protein specific to primates. This protein is a component of the choroidal extracellular matrix of the eye. Mutations in this gene are associated with age-related macular degeneration. [provided by RefSeq, Sep 2017] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223747 | ARMS2 (Myc-DDK-tagged)-Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein |
CNY 1200.00 |
|
| RC223747L1 | Lenti ORF clone of Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 3600.00 |
|
| RC223747L2 | Lenti ORF clone of Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5890.00 |
|
| RC223747L3 | Lenti ORF clone of Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 3600.00 |
|
| RC223747L4 | Lenti ORF clone of Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 3600.00 |
|
| RG223747 | ARMS2 (tGFP-tagged) - Human age-related maculopathy susceptibility 2 (ARMS2), nuclear gene encoding mitochondrial protein |
CNY 2800.00 |
