SVIP (NM_148893) Human Untagged Clone
CAT#: SC316887
SVIP (untagged)-Human small VCP/p97-interacting protein (SVIP)
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316887 representing NM_148893.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGCTGTGTTTTCCTTGTCCCGGGGAGTCCGCGCCTCCCACGCCGGACCTGGAAGAGAAAAGAGCA AAGCTTGCAGAGGCTGCAGAGAGAAGACAAAAAGAGGCTGCATCTCGGGGAATTTTAGATGTTCAATCT GTGCAAGAAAAGAGAAAGAAAAAGGAAAAAATAGAAAAACAAATTGCTACATCCGGGCCCCCACCAGAA GGTGGACTTAGGTGGACAGTTTCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_148893 |
Insert Size | 234 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_148893.2 |
RefSeq Size | 3204 bp |
RefSeq ORF | 234 bp |
Locus ID | 258010 |
UniProt ID | Q8NHG7 |
MW | 8.4 kDa |
Gene Summary | Endoplasmic reticulum-associated degradation (ERAD) is the pathway by which misfolded proteins in the endoplasmic reticulum are targeted to the proteasome for degradation. Multiple specialized proteins interact with one another during ERAD to complete this process. The protein encoded by this gene is an inhibitor of ERAD, functioning to disrupt the interaction of these protein components. This downregulation of ERAD may be needed to protect the cell from overactive protein degradation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (3) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (3) has a shorter and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221934 | SVIP (Myc-DDK-tagged)-Human small VCP/p97-interacting protein (SVIP) |
CNY 1200.00 |
|
RC221934L1 | Lenti ORF clone of Human small VCP/p97-interacting protein (SVIP), Myc-DDK-tagged |
CNY 3600.00 |
|
RC221934L2 | Lenti ORF clone of Human small VCP/p97-interacting protein (SVIP), mGFP tagged |
CNY 5890.00 |
|
RC221934L3 | Lenti ORF clone of Human small VCP/p97-interacting protein (SVIP), Myc-DDK-tagged |
CNY 5890.00 |
|
RC221934L4 | Lenti ORF clone of Human small VCP/p97-interacting protein (SVIP), mGFP tagged |
CNY 5890.00 |
|
RG221934 | SVIP (tGFP-tagged) - Human small VCP/p97-interacting protein (SVIP) |
CNY 4370.00 |